Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21530  (registered. 2007)
Contig Information
Length 1444 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 189
Evalue 2.98846e-12
Total Hit Count 110
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21530
ACTTGATTAAGCAGCATGGCCCAACGGCATTTACAGAAGGTAGAAATTGTCATAAGGAGGGAGATAAGGCAGAAAGGGCTGACGGCCATATTTACAATGC
ATAGTACTTGATTTGTTCGATGACCTAAATAGAGGAATTGTCATGACAATGGCTCGACATAGTTATGCGAGTGTCAAAGCCTTGTCTTACAAAGTTGCAC
AAAATAAACCTGGTGCACGCCCAAAAGTGTGCAGAGTTGACGATCTTTAGACCCGATGGCCAGACCATTGCTGTGACGCAGCAGAGCTGAGAAGCTCTCT
TCAGCAAGCAGAACATAGAAGATACCATATCTAGCCTAGTCCATGGAAGAACTACTGGTTCGCTTTCTTTGGAGCGCCAGCTGGCTTGACAGCAGTGTTT
GTCCTCTTGACTTTAGTGTGGTCAGGAAGGTTGTTCTTTGGATCTTCGGTAGCTATAAGCTCAGTTTCTTGACCGACATTTGGCACAGATGTAGCTTCAA
CAACATTTCCAGCAGGAGCACCTTGTTCAGCCTGGCTAGCCACCTTGGCAGCAGAGGCAGAGAGTTCAGTGTCCTCGGGCTTTGAGGGCTCAGTAAAAAG
TTTGCGGCGAGCACTTTTTGGGCATGCTGATTTGCTGGGTGTTTTAGGCATAATAGCCTGCCCTTTTCCTTTGAATGCAGATATAGGAGTGTTCATCTCA
TCAAGAGGCAGCACGACAAGTGTAGCTGATCCCGTAGGGAAAGAGGCAAGAATGGGCACCGCCGTGCCTGAGCTGTTAGCAGGAATCTGGCCATACATGT
GGGTGCCCTCTTGGTCAAGCACCACAATGCCAGTATGCACAAGCTGACCATCGTCAGTCCCTCCTCGGTACTGCCACACGCGAGACACGAGAACCTGAGC
ACATGTAAAAAACCTTCGCCACCAAGCAGGTCATCTCATAGATCAATCGAGTACGTCATACCCTAACAACTCTTTTTGGAAAATATCCTCATAAACCAGC
ACTTCATCTTGTAGAGTAGGCAATCCATGAAGGAAGGCTCGAATCAGCATAAGGGAGCGGGTGGATCCTCTTTCTCCCGCCACCAACGAAAGAAGGTACA
AGCATGTGCTGCTTCATCGGGATGTCTTCGACCATCTGGCTGTGGGTGACGAGGTAAACATTGAGGTCGGGCAGAAATGATGCAGCACGCCATCGAGGTC
AGTGCCGCACACGGTCAGTCATCCTTGTGAACGTTTCTCTTAAGTAGATGAGCATTTCACCTCATAGTATCAGCATCTCTCTTAAGTCCTGAAATGACAT
TTCACCTCATAATATCAGGTAATTAGAAGATTAAGCAAATGAGCATTTCACCTCATAATATCAACATTTTCTCTTAAGTCCTGAAATGACATTTCACGTG
TATTCAAGTAGCTCTTCACGATTCACATGTTCACACAGATATGA
page-top