Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11666  (registered. 2012)
Contig Information
Length 1046 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23Ž 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242054577|ref|XP_002456434.1|| hypothetical protein SORBIDRAFT_03g036240 [Sorghum bicolor]
Score 244
Evalue 9.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11666
TTTTTTTTTTGAAAGATAGAATACATGCTTTATTGCTATTTGCAGTGTACACAACTACTTACTACACATCAATTTGGAAACACCACAACAGCAGCCTCAC
AACTGTTCGAATATAATAACATCCTCCCAAACCGCCGAGACCAAAAACAGGAGAAAAGAATGGACTCCAAAATTCTCTTCATGAATTCATGAGGCCTTAA
ATGTACACAAGTTGATCGAGACGCACCAAAAATGGTGAGCTGGTATCAGTACAAAGCTGCACTTGCTCTCTCCGATACGCCTTCAAATTGCACGCAGAAA
ACACGTAGAAAAAGCATCTGATTCCCCCTAGTATCAGCGCCTCCTCCATCTCTACAGGCTGGAAGCAGGCCGCGTCGTCAGATCTGCTTGAGCTTCTCCC
CGAATGCCCACCGATCAAATAAAATGTAAGAGGCATGCATGGATGTGCTGACCATCGACAGGCCAACTATGTGTCATCATTCTGTAAGCAACAGATTCCC
AATGACAGATCTCACCCATCAGCGGTGGTGATGCCATTATCTTGTTATGTGCATTTTCGTTTGTTGATGTATAAGAGGACGTATGGACTCGAGGCCTTCA
TTCACACTACTTTGACTATGAATCATATCGGGCCCCAGATGTGAAAGATGAGAAGAACCCAGCTGCTGGTCCAGGAAGAATGTCGCTCAGCCCTACCTGG
CCATCAGAGAGCATGGAACCCCATCTAGATGTGTTCTCCCCAAATTTGCTCCCAACCTGCGTAACAAAGGACTTGAGCAATGGAGCTGCACTTCCAAGAC
TTGCATTATTATCATATTCTGATATGGTAGATCTTTCCCCATTTGAATATGATGATTTCCAAGGGTTCCTAGATGTTGAATCATCAGATGGCGACTGTAG
TGATGACTTGGGTGTTCTTGATGCTAGAGCTGGGGCACTGATTGGTAGGTACTTGAATCTTGGAACCTGGGAGCACCTCATAATATTTGAATCTGTATTT
GTTTTTGTTGGTAACTTTTGTGCCGCACCAGTATACATGTGATTCA
page-top