Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21508  (registered. 2007)
Contig Information
Length 1468 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_RDr Root of dessiccated seed 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_23352 [Oryza sativa Indica Group]
Score 1646
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21508
GGTTTGCACAATCCACCAGCCAAGCATTGACATCTTTGAAGCTTTTGATGAGTTGCTATTACTGAAAAGAGGAGGCCAGGTGATATACTCTGGGAAACTG
GGTCGCAACTCACAGAAAATGACTGAATACTTCGAGGCGATTCCTGGAGTGCCTAAAATCAAAGATAAGTACAACCCTGCAACGTGGATGCTTGAGGTCA
GTTCAGTTGCTGCAGAAGTACGCCTGAGTATGGATTTTGCTGACTACTACAGGACTTCAGATCTGTACAAGCAAAACAAGGTATTGGTGAGCCAGCTAAG
TCGACCAGAACCAGGAACATCAGATCTGTATTTTCCTACAGAATACTCGCAATCCATTATAGGGCAGTTCAAAGCCTGCCTCTGGAAGCATTGGCTGACC
TATTGGCGCAGCCCAGATTACAACCTTGTCAGATTTTCCTTCACTTTGTTCACAGCCTTGCTGCTGGGCTCCATCTTTTGGAAGATTGGCACCAATATGG
GGGATGCCAATACTCTTAGAATGGTCATTGGAGCAATGTACACAGCAGTGATGTTTGTCGGCATCAACAACTGTGCAACCGTTCAACCAATTGTTTCAAT
CGAGAGAACAGTTTTCTACCGAGAGAGGGCTGCTGGGATGTACTCTGCACTGCCATATGCCATTGCTCAGGTTGTCATGGAGATACCTTATGTCTTCGTC
CAAACCTCGTATTACACCCTCATCGTATACGCCATGATGAGCTTCCAGTGGACAGCTGTCAAGTTCTTCTGGTTCTTCTTCGTCTCCTACTTTTCCTTCC
TCTACTTCACCTACTACGGGATGATGACTGTATCAATCTCACCAAACCATGAGGTTGCAGGCATCTTCGCCGCAGCTTTCTATTCCCTATTCAACCTTTT
CTCTGGCTTCTTCATCCCAAGACCGAAAATCCCCAAATGGTGGATCTGGTACTACTGGATTTGCCCATTGGCATGGACAGTGTATGGGCTCATAGTGACA
CAATACGGAGACATGGAAGACATCATCACCGTCCCAGGCCAATCTAACCAGACAATCAGCTACTACATAACACATCATTTTGGATACCACAGGAGCTTCA
TGGCGGTCGTTGCACCGGTGCTTGTGCTCTTTGCAGTGTTCTTCGCTTTCATGTATGCTCTCTGCCTCAAGAAGTTGAACTTTCAAACACGGTAGGAGCG
GAAAGCCAACAGACAAGATCTCACAGGCAATATGGTCGATTTTTCTTGATCCAACTCTTCTTTTGTCCTTCCATTTTTGGGTCTATTTATGTGCCAGTGT
AAATACAGGTGTAGTTTTTTGGATTCCTTACATAGTCAAATACGATGAGGGTGCACCAGCCTTTCAGGCTTGGAAGTGTATTGCATTGCAAATTTGCAAG
ACTGCGATGAGCAGAATTTGTTCATGGCCTATAAATACATTGGAGTTTTTTCTTTCACAAAAAAAAAA
page-top