Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21476  (registered. 2007)
Contig Information
Length 988 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0103300 [Oryza sativa (japonica cultivar-group)] >gi|113563570|dbj|BAF13913.1| Os04g0103300 [Oryza sativa (japonica cultivar-group)] >gi|215692673|dbj|BAG88093.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215694630|dbj|BAG89821.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215706915|dbj|BAG93375.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1033
Evalue 2.34538e-110
Total Hit Count 260
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21476
CATTCTTTTTCTACATTACAACATCTGGGGCAAGGGGATGCCACCCTTTTTCTTCTTTCCTCACTGTAATCAGGAACTACAACACAATTTAACCAACCAA
TATTCTCAAAACAAGGAAACAGAAAAAGGGGCAGTAAAGTAATATCATATCATCGGTCCACTGTAAAAATGAATATGCTCCCCAGAACACAGATCCGAGG
AGTTACAAAGCACGGAGGCAGGCGACCGTGGCCACTATGGCGACGTAGCACAGGGGAAAATTTCTTAATCTTCCGCGGAGTGGGCTGGGGCTTCGGCGTC
AGCCGCATGGTCCGCGGCCATCCTTTCCTCGAGAACCCTCTCGCCACGCTCCCTTCTTCTCGATGCCTTGGTAGGATCGGTAACTGGGAGGGCAATTTCC
GAAGGCTTGGACCTCGCACACAACATCCGGTCGAACAGGTTAGCAACTGGGTCTGTGACTGGCCGCATGGCATCTGGGAACAAGCTGGGGAAGGAGAAGT
CATCACTTGGGTCGCCCTTAAGCCCTGTCAGTGGGTTCTTCTGGAAGTATCTCAGGTAAAGCCAGCTGACGTACATCCCAGACAACAAAGTCGGCAGGAA
GTTGATGGAATCCGGCACAATGAAGGCCATGATAGTTGAGAAGCACATGACAAAGAATGGCATCCACTTAGCCTTTATTTTCCAGAAAAAGCACATGGGG
AGCTCAAGGTTTGGCAACAGCTGCTTCAGGCCAACCAGAAAGCCGGCAAGGGCGCCATGGAAGCCAGAAAGTGGCGTTACAAGGAAGCTCTCTTTCCCGG
TGACATAGTACAGTGCGACAGCAATGCAGAACGCAAGGATGCCGCAGATGGAGTTGATCAAGATAATGAACTTCAAGAACTCCTTGCGGCCCCAGACTGG
TTCGATGTCCTTCCCGCAGAAGAGAAGACCAAGGGAACTGCCAATAGCCCCTGGGAGGACTTGCTTCAATGTAACCGGCCGTGAAGAC
page-top