Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21397  (registered. 2007)
Contig Information
Length 887 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09713 [Oryza sativa Indica Group]
Score 812
Evalue 8.27413e-85
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21397
CACGCACCACTCCAAGCAGAGAACCACAACATCAACGTAACTCAAAGCGAAGAACACGCTAGTTCAACCAAGTCATACAATAAGGCAGTACCGTGCGCGC
TAAGAGCATTTAGCATGTTTCACATGCCTCAGTGGAGCAAAATTTTATTACAGCCAACAAGATCCCTAGTGTTCCTCAAGACTAGCTAATAACTGGGTTG
GGCTGCTGGGGCAGCTTCACTTCTTCACCTCCTCGTACTCGGCCTCTGGGGCCTGGTCGCCTCCGCCCTGCGAGCCTCCTTCCTGGGAACCACCGCCAGC
CGCGCCGCCTCCAGCCGCACCACCACCAGACATGTGCTCCCCGATCTTTGAGACCGCCTTGTTGGCCACTTCCATCTTGCTCTTTATCTTCTCGATGTCG
TCAGAGGCCATCTCCGCGCGGAGATCAGCAACCGCCGTCTCGATCTCGGTGGCGACCTCCGCGGGGATCTTGTCCCTGTACTCTCCCAGGCTCTTCTCGA
TGCTGTAGATGGTGGTGTCTGCGGTGTTTCTGATGTCAATGAGGGCCTTGCGCTCCTGGTCCTTCTGTGAGTGCAACTCAGCCTCCCGCACCATCTTCTC
GATCTCGGACTCAGAAAGCCCACCGGACGATCGGATGGTGATCTGCTGCTCCTTTGCGGTGGCCTTGTCCTTTGCAGAGACCGTCACAATTCCATTGGCG
TCAATATCAAACGTGACCTCAATCTGTGGCAGTCCTCTTGGGGCTGGTGGGATGCCCACAAGATCAAACTCGCCAAGAAGTTTGTTGTCTGTTGCCATCT
CACGTTCACCTTGCAGGACACGGATACCCACTTGCGTCTGGTTGTCAGCAGCAGTTGAGAACACCTGGCTTTTCTTTGTGGGGATTG
page-top