Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21386  (registered. 2007)
Contig Information
Length 1274 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193453 [Zea mays] >gi|194693278|gb|ACF80723.1| unknown [Zea mays]
Score 1175
Evalue 1.16591e-126
Total Hit Count 99
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21386
AACCTCCCACCTCGCCGCCCGATCCGACGCGCCGGCGACCCGCCGCCGCGCTCGAGCGTCGCTGATCCGCGGCGCAGATCCCGTACGAGGTTTGCTCACC
TTATCAGCTCGAGGGTGCAGGGTTGACGCGCCTAGCCGGCTCTTGAATTTCAGCGCACGCGGATCTGGTGGGAGGAGCCCCGTGGGCGCCGCTGCCTGGG
CGATGTCGAGGGTCCGGGACAGGACGGAGGACTTCAAGGAGTCCGTCCGCGTCGCCGCGCTCTCCCATGGCTACACGGAGTCGCAATTGGCCGCGCTCAT
GTCGTCTTTCATCATCCGGAAGCCGTCATCCAAATCTCCGTTTACAAATGCAGCAATCAAGACGCTTGAGAGCATCAGGGAGCTCGAGAAGTTTATAGTG
AAGCACAGGAGGGACTATGTGGACATGCATCGCACCACGGAGCAAGAGAGGGACAACATTGAGCATGAAGTTGGTATTTTTGTAAAAGCATGCAAGGAAC
AGATAGATATCCTAAAGAACAGGATCCTTGAAGATGAGAGGAATAGAAGAGCGAACACATGGCTTGGCACAAGAGATGAGACTTCCCGGTTGGACCTGAT
AGCTCACCAGCATGGTGTGGTTTTGATTTTAAGCGAGCGTCTCCACTCAGTAACTGCACAATTTGATCGCCTTAGGTCCCTGCGCTTTCAAGAAGCTATT
AATAGGGTGATGCCAAGAAAGAAGATCAAGAAGAAGCCAGATATAAAACCTACTGAACCATCCAAGTCAAACCTTGTATTGAAATCTGATGTCTCGAAGG
TTGAAGACCGGGAGGTATCAACTGCGCCCTTAAGAGTTCAAGAACAACTCTTGGACGATGAAACACGAGCTCTCCAGATGGAGTTGACCAATCTTCTTGA
TACTGTCCAAGAAACGGAGACAAAGATGATAGAGATGTCAGCACTTAATCATCTTATGTCAACACATGTTCTACAGCAAGCTCAGCAGATTCAATATTTG
TACGACCAGGCGGTGGAAGCAACAAACAACGTGGAGCGTGGGAACAAGGAGCTATCCCAGGCGATCCAGCGGAACAGCAGCAGTAGAACCTTTCTCCTGC
TTTTCTTCTTTGTTCTTACTTTCTCTGTTCTGTTTCTTGACTGGTACAAAAACTGAATTAGCTCATGTAACCGTACTACTGTGCAAATGGATTGAGCTAT
TGACGCCTCGTCTCTTGTGGGATGATAATCACTTGTCGTGCATATTGGTCAGTTTTATTCTCTTAAAAAAAAAA
page-top