Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21316  (registered. 2007)
Contig Information
Length 1245 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192599 [Zea mays] >gi|194691086|gb|ACF79627.1| unknown [Zea mays]
Score 432
Evalue 1.61641e-40
Total Hit Count 15
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21316
TTTTTTTTTTATTTTCTGTACCAATTTTCTTATTTGAATATTGCTAGCAAAGAGCAGTTTCCAGAAAAAAAATCAGATTGCAACAATGACAGTACGCTTC
ACAACTGGAAGCTCGCCGGCCTCAGTTTCTTCATAGACGAGCGGGTGAAACATGTCAAGGCAGTACCCAGACTCGTAAACTCACACTTCTAGTAGTTCCA
CAATTACAAAAGCAAAACGAATCAATCACTGGAGATATATATGTACTGCTTGAGACCTTGGTACTCTAGCGTGGTGCCTTCTGAACAGCTCAATGGCCCT
CTATACCTGGTTTCTTATACGGACGACAGCCAGCGATAAGCTCGATCCTCTCAAAACAACCCATCACTAAGGCGGCGAAGGCGAAGGAGAGGCCGGCGGT
TTGAGATCTGGATAGTTCGCATATGGCGAAAGAGGCCTGGGCTTCGCAGGAGGCGATGACTCTTCGACAGCTTCTGCCACCGGTGCCGAGTTAACTTCCG
CCGGCGATTCGGTTGCTGCGACAACGGTGGCCTTCACCTCGGTTTTACCCTCTGAAGCTGGTGGGGAAGGGCTGGCCGGTGGTTTGAGATCTGGGTAATT
TGCAAATGGTGACAGGGGTCTCGATGATGTTGTGGTATCAGGAGGCGACTCTGTGCTGGCTTCTGCAGCTGGGGCTTCTGGTTCTGCTACTGGTGCAGCA
GTTGCCGTGGCAGCAGCTGGGGCTGCTGGTTCTGCTACTGGGGCAGCAGTTGCCGTGGCAGCAGCTGGGGCTGCTGGTTCTGCTACTGGTGCAGCAGTTG
CCGTGGCAGCAGGGGGCGCTGCCGCTGTTGCTGCTGCTGGTTGGCTCTTAGCTTCACCAGATGAAGGCAGGAGAGCCTGCCCGATTTCCTTAATTTCATC
AACAAGCTCCTTTGGCGCAATCTTCTTGTTAAAGAAATCATCAATCTGTTGCAGGGTCTTCTTTCGATCCTCGGCATACACGAGCTTGCTTGCCACAAGC
TGGACAATGGCAGCTGAACCCAGAAACTGTAGCACGGTTTCTATCTCTGTGTAGGCAAGTAATCCCAAACCAGTAGCTGCAGCAAGACCAATTGTGACAG
GCAAACCTTCTGAACCATCCCCAAATAGCTCACCGAAGTCCAAACTGAATCCCTTCTTGGGAGCAGTCCACGGAAGATCACTGCTCTGCAGTAGAGCACT
AGCAAATGGTGACATTTTGCAGAGCGAATATACATGTTAAACACT
page-top