Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21315  (registered. 2007)
Contig Information
Length 437 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Late embryogenesis abundant protein 1
Score 238
Evalue 7.50063e-19
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21315
CGGTGAAGGAGCGCGCGGCGGAGAAGGCGGCGTCCGTCTACTTCGAGGAGAAGGACCGGCTGGCCAAGGAGCGCGCGGCGGAGCGGGTGGACAAATGCGT
CGAGAAGTGCGTGGAAGGGTGCGCCGGCTCCTCCTGCGCCCACCGCAAGGGCAAGATGTGAGCGGCCGGGCGTCCCACGTGACCGACCGCGGGCGCGTCC
TCGGTGCGACGTGCACACGTATCGCGTTCTCGTGCCATCCATGCCGTCACTCCGAGCATGGCGGCGACAATAAACTTTAACTCCTAGTGGAGGTCCAGTA
GAGCCTTCGTTTTCAAGTTTCTTTTACTACCACCTTTTGTCTAAGTAGTGTAGTGTGTGCGCGTCCCTTAGTTTGAATCCATAAATGTCCTTCGGTTTCA
AGTTTCTTTTACTACCACCTTTTGTCTAAAAAAAAAA
page-top