Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21313  (registered. 2007)
Contig Information
Length 1847 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194403 [Zea mays] >gi|194695716|gb|ACF81942.1| unknown [Zea mays]
Score 1100
Evalue 7.99733e-163
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21313
ATAATCACTTGGGACCGAAACCTCAGAGTCCAACGCCGCCATTTCCCACCCGCCTCCTCCTCCTCCCAGCCGCCGCCGCCGCCGCTAAGTCCAAGGACTG
CGCTCGTTCTTGTGAACCCTCGCGGCCGTCGCCGACTCGCTGGGTCTGCTTGCTTGAGGAGCGGCGGGCTGGAGCTGCCTGCCTGCCTGCGCGCGCTGCG
AGGGTGGCGGTAACTTCCTCTGCGGTCCCGGATCGCGTCGAATTCGAGTTTCCCGGGGGACAGCTTCCCGGGGCTGGACGGTGGATTAGGCTGCGGTTGA
TCAGGATATGATGGCAGCTGTTTAAGGTTGGTGAAATGTCCTTGTGGATATCATAAGTTCAAACGTATTTATTGAACTGACAACGGTGAGGCTGACATAT
TCTGAGAATATAAGTAATGGGTTGTTCTCCTTTCTTCTGCTATAAAAGTGGGGCAACACGCCAGCAAATTTCTACGCATACTGAAGACCTCCCTGGTGAT
ATTAATACAATAAGATACACTTATAAGGAGCTAGCAAGGGCAACAGAAAATTTCAACCCATCCAACAAGATTGGCGAGGGGGGTTTTGGATCTGTATATA
AGGGGCGGCTAAGGAATGGAAAACTTATTGCTGTCAAGGTGTTATCTGTAGAATCAAGACAAGGACTAAAGGAGTTTCTGAATGAACTGATGTCAATTTC
CAACATATCTCATGGCAATCTTGTCAGCCCTTTATGGCTATTGTGTGGAAGGAAACCAGAGGATCCTTGTCTACAATTACCTTGAGAATAATAGCCCTTG
CTCAAACACTTCTAGGTTCTGGCCGCAGCAATATCCAGTTCAATTGGAGAAGTAGAGTAAATATTTGCCTTGGTATCGCCCGAGGATTAGCATACCTCCA
TGATGATGTCAATCCCCACATTGTTCATCGGGATATCAAAGCAAGCAATATACTTCTTGATAAGGATCTCACCCCCAAAATTTCTGATTTCGGTTTAGCA
AAGCTTCTACCTCCAAATGCGACACATATTAGCACACGGGTTGCAGGAACATTAGGTTACTTGGCTCCTGAGTATGCTATTCGAGGACAAGTGACACGGA
AGTCAGATGTTTATAGTTTTGGTGTTTTGCTTCTGGAAATAGTCAGTGGGAGATCCAACACCAGTTCAAGATTACCCTATGAAGACCAGATACTACTGGA
AAAGTTCCCAGAGGTTACCAATGGGGTTCTCCTCTTGCAGACATGGATGTATTATGAGCAGGGAGATTTGGCGAAAATCATAGACAGTTCTGCGGGTGAT
GATATGGATATTGAACAAGCCTGCAGGTTCCTGAAAGTTGGACTTCTCTGTACACAAGATGTCACAAGACATCGACCCACTATGTCAACTGTCGTCAGCA
TGCTAACAGGCGAAAAGGATGTTGACTCGGAGAAGATCAGCAAGCCCGCTACAATTAGCGACTTTATGGACCTTAAGATCAGGAGCATGAGGAGAGAAAA
TAACATTGCATTCGCTTCATCCTCCACGTTGCTATCCACTATCATGGCACACTCTTCTCCTTTTTTGTCGCAAGAGACGACACAAGCCTCCATCACATTC
ACCACAATATCAGAGCGTGAGTGACCTGAAGTTGGTTGCAAATACGGAGACCATGTAGAGAAGTAGCATAGCCAGATACCCCTTTTTCCAGAAGTTTCCT
TCGTAGTGTATAGATTCACTTTGTTTATAGTGTACACAGCATTGCTGGGACAAAGAAGTTCATGAGTTTTACTTTGTGTGTACAATACTAGATTGGTGGC
GCAATGCCATTGTATATGTGTGCATGTACATCCTGTCCGTTGTTGTT
page-top