Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21298  (registered. 2007)
Contig Information
Length 1222 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195619728|gb|ACG31694.1| endochitinase A2 precursor [Zea mays] (no hit)
Score 1013
Evalue 5.19291e-108
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21298
CCGGAGCCCATTCGGCCTGCTTCGTGCGTACATGTGTGTGTGTGTGTGCGAGATGCATGCATGCATGCATGTTGCATGTTGCATGTTGGGGGTTTTGCAA
TTTACTCCTGAGAGAAACCCAGCCAAGAAACAAATGCCATGACAGGTCAAGCACGGCGGCCAAGCGGGCTTCAACGGAGAAATGGATTCAGATCTCCGTT
CTCGCTTAGTAGTAGTACCACCACCACTTGTAGAATAGCCGCCATATCGAAGGCGCTGTAATCGCCAAGAAAAATAAGACAAGTTCAACAATGGCATGTC
ATGGACAAGAGGATGTGGAACACCTTCAAAATGCTAAGGACACATATTGGCAAAGCTCAAGACTCTTCATTTATATTTTAGTGATCCAAGATCACATTGA
GTCCATAGGAAAGCCAATACTATTAAAAGGGGATGAGGTGTTGCTTAATGGTCTACTTGCTCAAAATGCTTAGTGATATTGCTCCAAAGCCCTCAATCAC
TTTCCCATTTTCAAATATGTCCAAAACACAAAGTCAAACTCGGCCCCACCGAAATCTCCTATCCGGCGCCACCGAGTTTATTTGACATAGCCACTGCCAG
AAACCCTAACACCTCGGTCACACCGATACGGATCTCGGTCTCACTGAGATGGCCTTGCAAACTCTCTGTTTCCCTTTTTATAACATTTCAGTCTCACCGA
AATGAGCGATCGGTCACACCGAGTTTGCTTGATCTACTCTCTGTTTGCTCTTTGCTGAAATTGGTCTCACCGAGTTCACGCAATCGGCGCCACCGAGATG
AGGTTTTGCCCTAGCCCTAGCACATCGGTCCCACCGAGTTCTTCCAGTCGGTCCACCGAGATTCCTAACGTTCACATTTTGAACTAAATCGGTCTCACCG
AGTTCTTCTATTCGGTCAGATCGAGTTGGGTCAAATGTGTGTAATGGTTGGATTTTGTGTGGAGGATATTTATACCCCTCCACCCCTCGTCCATATGTGA
GAGAGCCATTAGAACGTGCCTACACTTCTAGCCTACATTTTCTGAGAGAGAACCACCTACTCATGTGTTGAGATCAAGATATTCCAATCCAACCACAATA
ATCTTGATTTCTAGCCTTCCCCAAGTTGCTTTCCACTCAAATCATCTTTCCACCATCACTACAAAAAAAAATACACTTCTTTGATGATACGTGTTTGTCA
CCAGTAGGTCACATTTTCTGTC
page-top