Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21278  (registered. 2007)
Contig Information
Length 1918 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27490 [Oryza sativa Indica Group]
Score 1572
Evalue 1.83387e-172
Total Hit Count 405
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21278
TTTTTTTTTTAGCAACGACCAAATCTTTATATTTCTTGCCATTCTTGACACTCGGGGAAATAAACAAGTAAATCAACAACAGCAATAGAAAAAGAAAAGG
ATCTTGATGGACTTATCACACATAAATACTTGTGCCACTGCATTGCTCTATTCATTCACAGGCCAGTTTGGTGTCGAAGCTGGTCAAGCAGATCGCGAAC
GCCTGGAACGCCGAGAGCGGGTACCGGTAGTCCATGGTGAACATGTCCTTGGTAACCTTACCAAACTGCAGGATCACTTTCTCGTGATCGGACGTCGAAG
ACGACGATGAACTTGAAGGCTGGAGCTGCTGCTGCTGGGGCGGCTGCGAAGGTTCAGACGGCGGCAATGCAGCAGCTGCCACCTGTGGCGCGGCTGCCGT
CAGCTGGAAGTTCTTCACGGAGGCCACAGTCACCCTGCCTCGGAAGTTGAGGCACCAGCACTGCAGCTGCTCATGCCATCTCGGCACCTTGTTGCGGAGA
ACCAATGGCCTCTCCTTGGCCTCCCCATCTTCTTCCTCTCGCCGCAACCCACCACTTACATCTGAGAATCGGGAGCTTGAGAAGCGAGAGCTGCTGAAGT
CTGCCATGGAGAACCTGGAGGAGGCGTTCGTGCTGCGGAAGGACTCGTCGAACGGACCGGGGAGCAGCTGCTGGGGTTGCCCAGGCACCACGCCATCCGG
GTCGACTGCAGAGGCTGGGATGGAGTGCATCGTGCACTGCATACGCCTCGGCCCCCTGGTGCCCAGCACGTTGAGCTCGTAATTCACCTGGGCGATGGGG
TAGCTACCGGTGGGCACCTTTGGTGACACCCTCCTGGAAGAGATGCGGCGGCTGCCGCGCTGGCATGGGACGAGGCTCCCGGCATTGTATGGCGGCTGAG
TGTCGTAGACGATGAACTTCGTGCCGAGGAAATTAGACCTCATTTTTCCAACATAGCCGTTGCTTGACCGCGAGATGTTTTTAGAATCCACAGAAATTAC
GTATTCGGTATATGTTGTTCGTCGATTCCTCTTGGCTGCTAGCAGGAACTTTCCGTTCTCACTAAGCACAGCAGGGCTAAGGCAGAGGTAGAGATAATAG
GTTAGTGTTGATTTGTCCCTTCTAATGAAGCACTGGATTAATCCATCTCGAGGTCCTGGCTGTTTAAGCGACACCGGAAAAGTGAGTTTCCCACAGAACT
CCGGGCTCTGAACTATATCTTTACAGATCTCTCTCCACGCGCTGCAGACCGCCGCACAAGCTACGACATCTTTGCGCGAGGGCCAAGTGCTCTCGCCTTC
CTCCAGCCTTTTCATCACATCACGAAGTAATTCAGGAGGAAGGCCAACCCAGCCATTCTGATCAGCCACCACAGCTCCGCCGTGCGGCTCACCCGGTGGC
CCGAAAGATTTCCCCCGGTGATGATGGCCGGAAAGACCAGGGAGGCCTGAAATCCTCACGTCAAAGCCCCGCCTTGATAAGCTTCCGAAGCTCTCTCTAA
CATCGCGGACTATGCTGCGGAAAGACATATCTGCCGGAGACTCTGCGATGACAACCAGAACTTCCCCGATTTCCTAGTGGTCAAGGTCTTCTGAATGAGC
TTTCCGGCACGGCCCCAAATCGAGCTCCTCGACCTGACGACCCAAAACTTGAAAGAGATTCTTCCTCTTCCGCGGGGAGGAGATCCCAACCTTTTGCGGC
CGAGGCCAGCAGCGAGCGATCTCTCCTCCGCTTTCCCCAAAGCCCCCGGAAGCCAAAGAAGACGGACAGGGGAGCAAAAGCGACGAGCTTTCCACCTGTG
ATTGAACCCGCGACCTTTCTCCTCCAGCGAGAAAAAGGCTTTCCGGCGCGAGCTTTGCTCCAAAAGATGCGCAGGAAAAGGTGGAACGGCACGGGGACGG
AGGAGGAGCCCGGTCCGG
page-top