Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21265  (registered. 2007)
Contig Information
Length 1022 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 547
Evalue 5.61159e-54
Total Hit Count 50
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21265
TTTTTAGATTCAACTTGCTTCATTGTATTGATGAGGGGCTTATAAAGCCAATTACAAATCGGAGTAAAACAAAACAATTCAAACTGAATTTGGAGACAGC
AGGAAAACCTTGTTCGGGGCGAACCTTTCCATATCCAAACTCTTATAGTATTCTAAACTAACAATAATAACTAGGGATAACTAGTCACGGCATGGGTTCG
ACTTTGATTGTAGTATCAGACACACTAACACCCCTATAAATGCCATCTGTGAAGTGGTGAGTAACTTCGTGTCCATTCAGCAGAACATCCTTCTGCGTAT
ATGAGTATGGGACATCACATATACCTTGTGACTGAGTCGCCGTCACCAAGACCTTGGACATTGGAGGCACAATGACTTGATATTTCATGGTGGTCTCTTG
TGTCTTGGTTATAGTTTCTCCCCAGCTATATCCTCCTTCAAATTCAGCACTAATTTCTATTTCCCCTTTCACTATGAGTGGAATCCCAGATTCAATGGTT
GACTTGACAGCCACTTTCAATGAAACACTAGAACTCCAGGTACTCTCCCTGGTCTCTTGGACTTTGAATTCTACATCTTGTGTGCCGGTTGTAGAGTAGT
CATTGATAAGATGAGCAGTTTTTACATCCTCGAGTTTCTTGAGCTGAACCTTAGCTTCATCCACGTGGAACTCAATGTCATAGATCTCTCGAGAAATAAC
CGGCTCTTCCAGATGGAATCTTGCTCGTCCTACCATGCTATCAGCACTAGCATTGAGGCAGTCAATCTTGCCGTCTGCGGTTAGCCTCTGACACAAACTG
CCATTGCCAAGGTTTCGAAGCGCTACCAAGTCATCCCCGATGACCACCACCTCGAACAAGGTGTCTCGGTTGTTGTTGGTGGTGTCGTGTGAGTCGGCCC
AAATCCAGTCCGGGCTGCGTCTCCAAAACTTGCTCTGGAAATCAGATTGTAAAACGGATGGATCCATCATCATTGTTGGTGAGAGTGTGCGACGCCCTTG
GATCTGTGATGNCATCTTTCGA
page-top