Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21242  (registered. 2007)
Contig Information
Length 876 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_004891 [Oryza sativa (japonica cultivar-group)]
Score 1009
Evalue 1.15702e-107
Total Hit Count 167
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21242
TTTTTTTTTTCGCAAACACAAGCTATTCCAGTTTACTCAGAACATCCCATAAAATTCTTCGGACCGACAAAAAAGGAAAAGCCAAAACTTATGTCAAGTC
TGACTTACATATGCCTATAGCAACAGACAAATCAATACAATCAAAAATGGTATTACATGGTACATATGGGGACAGGTTGCTAACTACGGGGAATGTCGAG
CGCGGTGGAGTCATTGAGCACCTTGCGGGCACGCCAGTAGATAGCATTTGATGTTTCTGATGTTCCCACCGTCAACTCCATATTGTAGTACTTCCTCCAT
AGTTCCCTTTCTTGTGGATAGAGGCTGATTGCTGAGTCATAGAGCTTGCGCGCGTTTACAAGGCCATCATTGTTTCCGATTGATGCAAGGTTAGCTTCCA
GCTCTATGCAGAACTGGAAGAACTTAAGACTGGGGCGCGGTAAAGCCAAAAATCTCTTATACATTTTCCTAGCTTGCTTAATACCATCTTTCTGCAAAAC
CCATCCGATAAAAGCTGAAGAGACTGAAGCTCCACAATCACTCCCACCAGCTGAACTTAATGATAGCATTGCACATTTCACCAGCTTTTCGAAATATATC
TTTTCATGAGAAAACAATTTCATCGCCGTATGCCAGAGTCCCTCAGCCTTGGTTATGGATAACTTCGGAAGTACAATATTAAATAAATCAAACAGAGAAC
TTAGATTCTCCTCACTAAAGGAAGCACTGCCGGTAGCAGTAGCAAGTGACTTTATCTCTATAGAAGCTCTCAAGTTCCACAGATTTGCAGCCTGTGAAAG
AGGACCACTGCAGAGCTTTTCTGCGAGATTCTTAGCTTCCTCCAATCTTTCAGGTGCTTCCTCCGACCTTCCAAGT
page-top