Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21236  (registered. 2007)
Contig Information
Length 613 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_RDr Root of dessiccated seed 5
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin-like protein 5 [Hordeum vulgare]
Score 385
Evalue 1.2872e-35
Total Hit Count 157
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21236
TCTCAATCGAAAAGCACAAGGCCGCTGCAGCTCTCGCCGGGGCTAGGGTTTCGTCGATCGATCGATCAGTCGACGCGAGCGGGAGCGAAGATGATCGAGG
TGGTGCTCAACGACCGCCTGGGGAAGAAGGTGCGCGTCAAGTGCAACGAGGACGACACCATCGGCGACCTCAAGAAGCTCGTGGCGGCGCAGACCGGGAC
CAGGGCCGAGAAGATCCGCATCCAGAAGTGGTACACCATCTACAAGGACCACATCACCCTCGGCGACTACGAGATCCACGACGGCATGGGCCTCGAGCTC
TACTACAACTAGCCTCATCACCCCCGCCATGTTCGTCACCTATCGTTGCCTGTGATGAGCGTTGGTTGCATTCCAGTCCCAGTGTCTTCAGAGCTCGATG
TGTGGGCTGAACTCCAGCGAGCTACTATATAAGTAGTGCATTATTGTACCCATGATGATTATTGACAGCCTGAACATACTTTTCCTGTGATCGACCTGCG
AATCTAATGTGCTGTTACTGTGAAGTTTATAAATAACATAAACTGTGTTANCCTGGGGTTGTGATGATGGCAGTATTACACTGTCACATCATGTTGTTAT
GTTAAAAAAAAAA
page-top