Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21221  (registered. 2007)
Contig Information
Length 1701 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|215741073|dbj|BAG97568.1| unnamed protein product [Oryza sativa Japonica Group]
Score 883
Evalue 1.95885e-97
Total Hit Count 162
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21221
TTATACGGCTTATCATATGACAGCTCTCTGTACAACAAACAACTCGGGTGGCGAAAAAAAGTCACAACTGACGGGAGATCCAAGAAAAAGAAAGGAGACA
TGTATGTGTCCACGTAATAAAGTTGACGTATGTACAGGATACATGATTCAAGCAGCAGCCTGGAAGTCCCCAAAGTCAAACTCATCATCCACGCTTCCTT
GTTTGCTCTTCTCTGCTGCGGCTGGTTGATTACGAGGAGCAGCTTCTGCTCTAGCTTCCACGGTATCATCCAGTGCTTCTTCTTGTGAAGGAAACTCTGC
TTTGAAAGGAGCAGCGGCGGCTCCAGCATCCCCGGTGCCTGGTTGTTCCTGGGAAGGAAATTCTGCTTTGAAAGGGGACATGGCAACTCCAGAATCAGTT
GGAGACACGGGTGAGGGTGGAGGTGGTGGGAGTTTGAGGGACACTGTGGCCTCCTTGGTGTTTGTTTTTTCATTGAACGACAGCTTGTTCAGGCCTTGCT
CGAAAAATGCAGATTTCGTCTTGCTGCCACTTTCTTTATTTTTTAGTTGAAGAACTAAAGTTTCCCCTTCTTTGAGGCTATAATCCACTGATGATGTATT
CTCATAGTGCTGCACCATCTCTTCAGCGGTCTTCTTCTTGTTCAGATATTTCATATGGTCATGTAGAGCAGCTTGGAAGTCATATGCTTCAGTTCTTTCA
CGGAAGCCTAAACCTATAAAAGCATGACGCTGACGCCCATCTATATTCTCTTCAACGCGAAGTACAAAATATCTGCTGCTATCAATTACAGCTTCCACCG
GATGTGGTTCGCCTTCTCTCAGAAATGCCCTAGCATACAGCTCACCAGTGCTCTTGTCTTCTAGTTTGATGACACATTCTTCTCCCTTGCTGGCAACCTT
AAGTGCCCCTTTCCCAAGCCCATTTGTTGACATTCCACTCATCAGCCCTAGATGTCACTAATGTAAGATCATTTTCAATAAATTGCGGAAGGCATGATAT
GGTCTGAGGAGTGGATTAATCCTATGGTGGGGTAGTCCATGATATATGTAGGATTTCCTTCCTAGTCTTTTTTTCAATTATCACGTTCGTATAAGCAATG
ACGCGGTTGCGAACTGGTGATACATTCAAACCAAATAGAAGATAAGTTCAATCCATCACTCGAACCGGACACCAAAAAGGACGAACAGGCAATCGTGAAG
CAAAATAGTGCATTAGCTTTGCAATCAAGTTTGCAAATGCGAAAAAAATGCTGAAACAAGGCCTGCAACCTTTAGCTAATTGTGATTTTCCTGGTCTATT
TAGCTACTAACGCTATTCAACCTGACAGTCAACAGATACAAATCCTAACAAACCGTTATCAGATTCTTCAACGAACTAAGAGGAGCAGAACCTGTAAGAG
GCGGCCGTCTTCCTAGGAGGTATCAGATAGACGTAGCACTCGGCGACCTGGAACAGCACGAGCTCCACCGCCTCGGGCTCGGTCTCCGCCTGCGGCTGCT
CGCTGCCGCTCGCCATGGCGCCGGCCGCCGAATCAAGGTAGGGGTATAGACCTCTCTTTGCAGGGGAGGAGCGAATCGGGTGCGGGGGTGATTTGGGAGG
GATCGGGTGGGATAAGCAGTGGTTGGATCCGAGCTCCGAATGTGGCGACACGGAGTGTGAAGAGGAGGGATCCTTTGGGTTGGGAGGTGAGAGGGGAGAG
A
page-top