Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21217  (registered. 2007)
Contig Information
Length 1261 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 3
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11365 [Oryza sativa Indica Group]
Score 1449
Evalue 1.94282e-158
Total Hit Count 217
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21217
ATGGTATAATCTGGTAGCTTGTGGAGTACGGTCATTTCACAGAAGCCTATTGCTGGGAACCTAAGGGTCAAAAATCTCCAACAACCAAGTGAACATTATT
ACAACAACGTTTCAGCTTGTTTTAGATAAACAAAGAATCATGGACGCCCAAATGCCCATGCTATCTAAAGCAGCTGAAATGAGACAACCGCAAGTACACC
GAAAAAGCCTGCAACGCTTGAGGAGCGAATCTGTAGGTCCCGAACACTTGAACCGAGACCATATGGTAAACCTGCACTTATAACGAACTGAGGAGACATC
TGTAGTCCTCTCACAGTAATTGCTGTGAGCATATCTACTCTCCTACAGTCATTCCAAAACCAAACTTGTAGTTCTTCTTTGGATGGTCAATCTCTGCAGA
CAGAAGAAAGTTGACACCCATGTTCAATCTCTCCTCCAAGTATGCAGCAACGACACCATTTGAGTCAACTTTGCCCCTTAGACGGCACTGCCTAAGGATA
TAATCGTAACCAACGCTGGAAGTCACATCTCTGGACATGTGGTTATACATAAAGTCAGTAGCAAGAGATACCTTTTCAGAAACTTTCTGGACATAACTTA
ACGCAACAATACCAGTGCTAGCAACCTGTAGAGTACCCACCATCTTATCTGTATTGTAGCGAGAATTAAATCCAATTCCTGACTTCCTTTGCTGACCAAG
CCAGAATATCTCTGTTCCCATCGACAAATTTGGCGTAACACTCTGGATATAATTTGCCCCATAGAACGCATTGTTTCCAATTTGAAACTGTGCTCGATAG
TCGGTGCCCTTGTAGTCAAAGTTGAACATCCCTTGAGAGTAATGAGGCTCACTAGTAAGCTGCGCATTTATTTTCAGCGCGAGATTCTCTGTCAGATCAC
ATTTCACACGAGCATTCAGCCTTCCATCAGTCATCAACCTTCCGATAAGCATTAACTTTGGATCTAAAAAATTGGCACCAAATTCATACTGTGATGTTGG
GACTTTTATAACATCAGCTGACTGAGACGGAACTTCCAGGGAGCCCATAAGGACACTATGGCTAAGAGCGAACTTCTGGGTTAACATCTTTGTGAAGTCA
AACCTCAAACCTTCAAAAAGTTCAGGCTTCAGAGACATGAGGGCCTCGCGCTGGATCTCCTCGTACGGCACGGGGCAGGGGAGGTTGAGGTAGTCCACCT
TCTCCTCCTTCTTATCATCCCCATCCGGCTTCTGAGGGAGGATGCCGGCGAGCCCAGCCCC
page-top