Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21179  (registered. 2007)
Contig Information
Length 1089 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1413
Evalue 2.3596e-154
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21179
ATATGGGATAGTGTGAAGAAATGCAAATAGCAGTTTTAAGTAAAAAAAGGAGGGGCGCAGAAGAATTCATTCTCTTGAAAAGAATAGTAGTATTGCCAAG
ATGTATAAAATCAAACATGTTTCTCCAATTAGAACATCTTATTTGCAGCGTAGCCATGTCAATGCCTGGAGGTGTGTCAGCTAGCAACTTGAGTCTGCAA
CAGCACCTGATTTTGCTCGGTCATCTTCGATCATGGCTTTGATGTAGAATTCGCCTGCTTTGTAGGAGGACCGAACCATCGGACCGGATGCAACATAACG
GAATCCCATTTCAACACCAAGGGCGCGGTAGTTCTCGAAGGCTTCAGGTGTAATATACTCAGACACTGGCATATGTCGCTTTGACGGCCTCATGTACTGA
CCAAATGTAATGACATCAACACCAGCAGCTCGCACCTTTTCCATTGTGCTGATAACCTGATCGGGAGTCTCCCCACAACCCAGCATGACTGATGTCTTTG
TGAGGGTGCCAGGAGGGGCATACTCCTTCGCCATTTTCAGAACATCCATTGATTGCTTAAAATTTGCACGGTGGTCCCGCACACTTCTTTGAAGCTCTTC
CACCGTTTCAATATTGTGTGCAAAAACATGCAACCCGGAAGTTGCTACCTTTTCTACACAACTTCGATCTCCTTGGAAATCAGGCACAAGCGCTTCAATA
AGCATATCTGGCTTTAAAGTCTTCAACCTCTGTACTGTTTCAGCAAAATGGCCGCTCCCCTGATCAGGTAAATCATCCCGGTCCACACTTGTGATGACTA
TATATTCAAGGCCCCACGATGCAATAGCTTGCGCAACATTGGCAGGCTCATTAGGATCTGGTGGAGGAGGGGTTCGTGATGTCTTGACATTGCAAAATCT
GCATCCGCGTGTGCAGGTGTCACCGAGGATCATGATGGTGGCAGTGGCGGTGCCGGTCTCGCCGCCCGACCAGCACTCGCCGAGGTTGGGGCAGCGCGCC
TCCTCGCAGACGGTGTGCAGCTTCAGCTCCCGCAGCTTGGCCTTGATGGCCGCGTACTTGGCCCCGCCGGGGATCGTCTCCTTCATCCA
page-top