Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21156  (registered. 2007)
Contig Information
Length 1705 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010898 [Oryza sativa (japonica cultivar-group)]
Score 2312
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21156
GACTGGACAGAGGCACAGTTTCCTAGGGAAATATAAGCTTGGATTTACCAATGACGGGAAGATACAGGCCTTAGATCTCGAAATTTACAACAACGGTGGT
AACTCACTAGATCTGTCCCTTGCAGTCTTGGAGCGTGCTGTTTTCCATTCGGAAAATGTGTACGCTATACCAAATATCAGAGTCAGTGGGAAAGTATGCT
TTACAAATTTCCCAAGCAATACTGCTTTTAGAGGTTTTGGTGGTCCACAAGGCATGTTGATTGCAGAGAATTGGATTCATCACATGGCTACAGAACTCAA
GCGGAGTCCAGAGGAGATAAAAGAACTTAATTTCCAAAGTGAGGGAACTGAGCTTTATTATGGCCAGCTGCTCCAGAATTGTACAATGCATTCGGTTTGG
GATGAACTGAAGGCATCTTGTAATATTTTGGAGGCTCGCAAAGCTGTAAATGTTTTTAACAGTGAAAATCGTTGGAGGAAGCGAGGCATTGCTATGGTTC
CCACAAAATTTGGCATATCCTTCACTGCAAAATTTATGAATCAGGCTGGTGCTCTTGTGCAAGTTTACACTGATGGTACTGTCCTGGTAACGCATGGCGG
GGTTGAGATGGGACAGGGTTTACACACAAAGATAGCCCAAGTTGCCGCCTCATCACTAGATATCCCTCTAAGCTGTGTATTTATCTCAGAGACAAGTACC
GATAAGGTTCCAAATGCTTCACCAACAGCAGCCTCTGCCAGTTCGGATTTGTATGGTGCTGCAGTTTTGGATGCTTGTCAGCAAATAAAGGCTCGGATGG
AACCCATTGCTAGTAGGGGGAATCATAAGTCCTTCGCTGAGTTAGCTCAAGCATGCTACATGGAACGGGTAGATCTTTCTGCTCATGGGTTTTATATCAC
CCCTGATATCGGGTTTGACTGGATTGCTGGCAAGGGGAGTCCATTTAATTATTTCACCTATGGAGCCGCATTTGCAGAAGTTGAGATTGACACCCTAACT
GGGGATTTCCACACAAGGACAGCTGATATTGTCATGGATCTCGGCTATTCGATTAATCCAGCAATTGATATTGGTCAGATTGAAGGAGCTTTCATCCAAG
GTTTGGGTTGGGCTGCCATGGAAGAGCTAAAATGGGGGGATGACAACCACAAGTGGATTCGACCTGGACACCTTTTCACTTGTGGTCCTGGCTCTTACAA
AATACCCTCTGTAAATGATATACCTCTCAGTTTCAAGGTTTCACTATTGAAGGGTGTTCCAAATCCAAGGGCTATACACTCATCCAAGGCTGTAGGAGAG
CCACCGTTCTTCCTCGCTTCCGCTGTCTTGTTTGCGATAAAAGACGCGACCGCGGCAGCTAGGGCGGAGGAGGGTCATCTCGACTGGTTCCCCCTCGACA
ACCCGGCAACGCCTGAAAGAATAAGGATGGCATGTGTTGACTCCATTACGAAGAAATTTGCGAGTGTGTATTACCGTCCCAAGCTTAGCGTATAGTGGTT
ACTGCCAGAGTAGCCGATACATACAACGTAAATGTGTATACCTGTTTATGTGGTGTACTATACTGTACAGTACAGACTCGATGTGTTCAAGATAAAAGTA
CAGATGAAGTGCCGATTTAGGATTATGAATACTACATATTTCAAATAACCCTGTATCTGAAATACCGAGCAAAAACAAATAGTTTGATTTTTTTCAAAAA
AAAAA
page-top