Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21118  (registered. 2007)
Contig Information
Length 1290 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0296400 [Oryza sativa (japonica cultivar-group)] >gi|108707648|gb|ABF95443.1| Eukaryotic translation initiation factor 2 alpha subunit family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548300|dbj|BAF11743.1| Os03g0296400 [Oryza sativa (japonica cultivar-group)] >gi|125585924|gb|EAZ26588.1| hypothetical protein OsJ_010071 [Oryza sativa (japonica cultivar-group)] >gi|215679025|dbj|BAG96455.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215707003|dbj|BAG93463.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1288
Evalue 9.3882e-140
Total Hit Count 272
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21118
CCCCCACCGCCGCCGCCGCCCGCGAAGATGCCGCCGAACCTCGAGTGCCGGATGTACGAGCCGCGGTTCCCGGAGGTGGACGCGGCGGTGATGATCCAGG
TGAAGCACATCGCCGACATGGGCGCCTACGTCTCGCTCCTCGAGTACAACAACATCGAGGGCATGATCCTCTTCTCCGAGCTCTCCCGCCGCCGCATCCG
CTCCATCTCCTCCCTCATCAAGGTCGGCCGCCAGGAGCCCTCCATGGTGCTCCGCGTCGACCGCGACAAGGGCTACATCGACCTCTCCAAGCGCCGGGTC
TCGGAGGAGGAGGCCGCCACCTGCGAGGACCGCTACAACAAGTCCAAGCTCGTCCACTCCATCATGCGCCACGCCGCCGACACCCTCGGCGTCGACCTCG
AGCCCCTCTACCAGCGCATCGGCTGGCCGCTCTACCGCAGGTACGGCCACGCCTTTGAGGCCTTCAAGCTCATCGTCACCGACCCCGACGGGGTGCTCGA
CGTCCTCACCTACGAGGAGACCGTCGTCGGACCCGATGGCGAGGAGGTGACTAAAGTTGTGCCGGCGGTCACCCCTGAGGTTAAGGATGCCCTGGTCAAG
AACATAAGGAGGAGAATGACACCACAGCCTCTTAAGATTCGTGCTGATGTTGAGATGAAATGCTTCCAGTTTGACGGTGTTCTCCACATTAAGGAAGCCA
TGAGGAAAGCTGAAGCTGCTGGAAACGCTGATTGCCCTGTGAAGATTAAGCTAGTTGCTCCTCCGCTTTATGTTCTGACCACACAGACACTTGACAAAGA
CCAGGGGATAGCAGTTCTGACAAATGCAACCAAAATTTGTGCCGAGGCAATTGAAAAGCACAAGGGGAAATTGGTGGTGAAGGAAGCAGCTAGAGCTGTG
AGCGAGAGAGACGACAAGCTGTTTGCGGACACGATTGAGAAGCTCAAGCTAGCAGGTGAGGAGGTCGACGGCGACGACGATAGCGAGGAGGAGGACTCTG
GCATGGGAGACGTAGACTTCACAAAGGCTGGCGCTGGCGCGGACTGAGCGGGTCTCCTCCCAGGTGGGATGAGATTGCTTGTACAGCGCCAGCAATGAAG
GGGAAGAATGTTTGGCTCCTCCTGTTTGTTTGAGGAGGCACGTTGGATGGATGGACGAGTGTTTACTCTGTTATTAGATATTGATGATCAGTTGTAGGCT
ACCCGTAGTCTTACAGATTGATTTGCTTTTCGCTGAGCACTGATTCTGAATACTGTTAATTGCGCTTTTGCTACCTGTTTCATCAGCATT
page-top