Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21104  (registered. 2007)
Contig Information
Length 1643 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11369 [Oryza sativa Indica Group]
Score 1689
Evalue 0
Total Hit Count 214
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21104
GTACCAGGCCGACAACGCCATGCCGGGCTCCGAGAGCGAGCTGGCTTCCGGCACCACCAGCCCGCACTCGCTGCAGGAGCTGCAGGACACCACGCTGGGC
TCGCTGCTCTCGGCGCTCATGCAGCACTGCGATCCCCCGCAGCGAAGGTTCCCGCTCGAGAAGGGCATCTCTCCTCCATGGTGGCCGTCCGGCGACGAGG
AGTGGTGGCCGGAGCTTGGCATCCCCAAGGACCAGGGCCCGCCCCCGTACAAGAAACCCCATGACCTCAAGAAGGCTTGGAAGGTGAGCGTGCTCACCGC
TGTCATCAAGCACATGTCGCCCGACATCGAGAAGATCCGGCGCCTCGTCCGCCAGTCCAAGTGCCTCCAGGACAAGATGACCGCCAAGGAGATCTCCACC
TGGCTGGCCGTGGTGAAGCAGGAAGAGGAGCTGTTCATGAGGCTGCACCCGGGCGTTCGCCCTCCAGCGTCTGCCGGCGGCATCGCCAGTGCCATATCAT
TCAACGCCAGCTCGAGTGAGTACGACGTTGACCTCGCCGACGACTGCAAGGGCGATGAGGCCGGCACCCACAAGATGGCCATGGACGATCCAACCGCCTT
CAACCTCGGCGCGGCCATCCTGAATGACAAGTTCCTCATGCAAGCGCCCATGAAAGAGGAGACCGGCGATATGGAGTATGTCCAGAAGAGGAGCGCGGTG
GCCGCCGAGCCGGAGCTGATGCTGAACAACCGCGTCTACACCTGCAACAACGTCCAGTGCCCACACAGCGACTACGGGTACGGCTTCCTTGACCGGAATG
CGCGCAACAGCCACCGGTACACCTGCAAGTACAATGATCCCCTCCCGCCAAGCGCGGAGAACAAGGCAACGCCACCTGCGCCGCCGCAAGTCTTCCCGGC
AGCCTACAACCAGCAGAACCATGGGCTCAACAACCTGGATTTCGGCCTCCCCATGGACGGCCAGAGGTCCATCGCCGAGCTGATGAACATGTACGACACC
ACCTTCCCGGCCACCAACAAGAACATGGGCAACGACGACGTCACCATTATAGAGAGGCCCAATGCCATCACCCCAGTAATGGACGAGGGTTTCTTTGGAC
AGGGCAATGGAATTGGAGGCAATGGCGACAGTATGTTCAGTGATGTGAGTAACATGATGCAGCAGCAGCAAGCACAACAGCCACAGCAGCAGCAGCAGCA
GCAGCAGCAGGCCCCGGCGCAGCAGCAGTTCTTCATCGGTGACGACGCGCAGGCGCAGTTCGGCAACCAGATGGGCAGCATCTCCGGCGCATCGGATTTC
AGGTTCGGCTCTGGCTTCAACATGTCTGGCACCGTCGACTACCCGCAGAAGAACGACGGCCCCAACTGGTACTACTGAATGAAGAATAAACTCCTAGGGT
CATAAGCTTTCTTCGTGGCAAAACCAACCTTGTGTTTCCATGGGGAAGTGTCGTCGTCGTCCTCCTAAGAAGTGGGTAATTCTATAGGTCTTCTCTTAAT
TTTCATATAGGTTTTGCAGTAGTTGCAAATAGGCTGGAACTTGGAACTGGTTATATACATGTATGTCCATCCAGCTGGTGAACCTCTTCTCTTATGGAAA
ACTTAATTTTATTCCTAGTTGAACTTGTTAGTTAAAATGCTGT
page-top