Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21070  (registered. 2007)
Contig Information
Length 1016 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit IQ calmodulin-binding motif family protein [Zea mays]
Score 821
Evalue 9.391e-86
Total Hit Count 34
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21070
ATTAAGCACCAAACTCTTCTACTGGTAGTTCAACAACAGCATACATTACAACAAGTCCAAACAAACAATACGGTTCATACACGCTACGACATCCCGGATA
ATGGTGCACGACAAGTTCAACCCTTCTCAAATCTCAAAGGTACTAGAAATCTAAGACGAACCGGACTATCTCACAGACAAAGCGGCGCTACAAGCTCCAT
CGATCGGCCATGGTACCGGGCACTAAACGAGGCGCTAGTGCCTACTGCTTGCCCTTGCCAGTGTTGATGACTCTGACAGCGTTGTTCACGCCAGCGGTTT
TCTCATTTGGGATCGCTCCGCCCTCTGGAAGATCGAACTTGCGGCGGTTGAACGACCTCTGCTTCCCTGGTGGCTGCGGGTCCACGATCTCCAGCATGCT
CTCCAGTTCCTCCAGCATAGATTTCTTCGCCGTCCTCACCATGAAGTCAGGTCCCTCGAGCGCGTCGACAGTGAGGAGCAGGACAATGATCTTCTCGGAG
AACCTCTGGCGCTCCTCGTGGTCATGCGAGAGGCGGCGCCTGTAGGAGAGGTTGTAGAAGAGGGACCTGAGCTCCTTGAGCTTGGCCTTGGCCACGGCGA
GATCGCGCAGGCAGCGGAGCACCTGGGAGCGGTGGGCGAGGTGCGCCCTGTAGTTCATCTGGATGAGCAGCGCGGCGTCCTGCGGCGACAGCTCCTTGGC
CTTCCCCTTGCCGTTCCCCATGGCAAAAGCCTTGCGGATGGCGTCGCATCCGGCGGTGTTGTCCTCGGGGATCTCCTCGATCTGGACGCACGTCCTCGCG
GGCTTCTTCTTCGTCTTCTTGTCATCCTCCTTGATCTTCTTGGGCTTCTCCGGCCTGCGCTCCTCGACCTCCAGCTCATCGTCGTCGTCGGAGGCGGTGA
AGTCCTCCTCCCAGGTGTATGCGTGCGACCATGGCTGGAGCGAGCCCTTGCCCTTGATCTCGGTGCCCCACTTGGTCTTGGCCTTGCCGCCGGGCTTGGA
ACTTGGCCTCCCACCT
page-top