Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21064  (registered. 2007)
Contig Information
Length 1005 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_OKCS Seed DPA5 3
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small basic membrane intrinsic protein1b [Zea mays] >gi|75308067|sp|Q9ATM2|SIP12_MAIZE RecName: Full=Aquaporin SIP1-2; AltName: Full=Small basic intrinsic protein 1-2; AltName: Full=ZmSIP1-2; AltName: Full=ZmSIP1;2 >gi|13447815|gb|AAK26765.1| small basic membrane integral protein ZmSIP1-2 [Zea mays]
Score 837
Evalue 1.29104e-87
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21064
TTTTTTTTTTAACATGAATGACTGATAAATTATCACTTTTAAGTTAAACATCGATGTAATGTTGAGGGGATTAAATACAGGCCTTCCAAATTATTCCCTA
GCAAACCATGTTCCCTTCTTCAGGTCCCCCAATTGCTAAGTCAAAGTTTGTGCTTGAGTTCATCATGCTTTCTTGGTCTTGGGCTTAGGGGCCGGTGGCG
GGAACACGGCCCTGAAGGTCCACGCAGCGAGAATGGCACCGATGAAGGGGCATATCCAGTACACGTACAGCTGCTCCCAGGTGTTGTGCAGATTGTTAAC
ATACGCCCAACCAAAGGCGTTGGCAGGGTTCATGGAGGGGCCGGTGTACGCGGCGCCGGTGAGGACGAGGCTGACGGTGGAGACTGAGAGCATCGCTGTC
TTGACGATGGGGTTGCGGGGTCCCTTGACGATGATGCAGAGGACGGCAAAGGTGATGACGAAGGTGAGCACCCCTTCAGCGACGGCGCCGGTGTGGGGAT
CCACCTTGAGCGAGGGTCCGCCGAGCATGTGCTTGTACTGCTCCGGCATCAGCTCGGAGATGGCCAGAGCTCCGCCCACGGCTCCGGCGGCCTGCGCTGG
TAGGCGGAGCGCGATGGAGAATAGCGAGGGGCTGGTGAGGCCCGCGGCGTAGAAGGCGGCGACGCCGGTGGGGTTGAAGCTGGCGCCGCCGAGGGCGTCG
CAGAGGAGGTTGAAGGCGAAGAGGAGGAGGGCGAGGATGGAGACGGTGACGAGGAGGGCGTAGTGGATCCCCTCGTGCAGGCTGAGGTAGGTGGTGACGG
CGGCCGTGGAGGCGCCGAGCGTGGAGACGCAGAGCACCCAGAGGAAGGTCACGACGCCGTCCGCCGCCGCCTCCCGCACAGCCGTTCCCATCGCCATCCG
AGCGTTCCTTCCGTGCTTGCTTCCCTCACTCCGTCGTCGCTGCTGGCAGTGATTGGTGGGTTGGGTTGGGTGTATGTATGGGTCTGGCTTGGCACACAGC
ACAAG
page-top