Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21008  (registered. 2007)
Contig Information
Length 873 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L9 [Zea mays] >gi|195624144|gb|ACG33902.1| 60S ribosomal protein L9 [Zea mays]
Score 861
Evalue 1.66781e-90
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21008
TTTTTTTTTTATCAGCAGGTAAAGACAGCATCTCCAAGCTCCAGCTTCCATGACATCCCTGGATACATCGATCCGGTACAAAACTACAGCAAACTTTTCG
TTGATTCACTCAAGCCAAACAAAAAGAAGAAGAAGAAACAGCTTGTAAATCTTGGTTTCGACAAGCTCCAAGAACTCTAGGACAGTTTCTGCTACCAGCT
ACAAAGGGGCTGCGGATGGATAGGTCACCACAACACTACTCTTCCTTGATGGCGCCCTTGTCGCTGACGTAGATGCCGTCCAGGAACTTCCTGATGTCCT
TGTTCTTCACGTGGCATTTCTGGTTGATCAGGGCAGCAGAGCGAGAGACTAGCTCGATGTCGTTGCCATCCAGGACAATCTCATCCTTAACTTTCTCGGA
CCGCAGGATCGTCACACCGTCAAGCATGTCTACTTTCCTTACCTTCTTCTCGCCGAGGAAGTTCCTGATCTCGATGCCCTTGTTGGCGGCGGTGATGGAG
GCGTTGATGGGGAAGTGGGCGTAGACGAAGCGCATCTTGTAGCGGAAGCCCTTGGTGACCCCGGTGATGAGGTTCTGGACGTGGGAGATGGCGGTGCGGA
TGGCGGCCATGGTCTTGCGGGTGCCGAACCAGGCGTCCACCTTGAGCTTCCGCCCGCCTTCCTGCAGCTGGAAGTCGAGGTTGAGGTGCTTGAAGTTGCG
GGTCAGCGTCCCCCGGGGACCCGTCACCGAGATCATCTTCGCCGACACCTTCACCGTCACCTCCTCCGGGATCTCCATCGTCTCCGACGCCAGGATCGTC
TTCATCTTCGCACGCCGGGGTTTGCTCTGGTCGCTTCCTCTTCTTCTTCCTCNACGGCNGNGGNNGNNGCCCT
page-top