Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20987  (registered. 2007)
Contig Information
Length 1903 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37912 [Oryza sativa Indica Group]
Score 2034
Evalue 0
Total Hit Count 304
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20987
TTTTTTTTTTGGGCAAAGAAACGAATTTTTGGCAAAGCATCGAGAAGATAATCAAACTACAAATAGCGGTATGCAGCATCAGAGCATAACTACTGTCATG
CAATTACCAGCTCTGGGTCGACAGATTCGGTAATTCTAAACCAGCCGTTACAATAGAATAGCTGAGCCAAGCCAATTTTCGTGCATGTTCTTCTATGCAC
AAAATGAAAAGTGAGCATGTCCAAGATACCATTGCTAACTCTCAATCATGAAAATGAACACACAGAACGAATCTACACTGCTGGAAAAGCAAATCAATGC
ACATTTGTGTGCAATAAAACTGTTTGCAGATCTAGTGGAGATCGACAATATCCTTGTTACACTCGAACAGGTTTCCTTAACTGCCAGGGTTCCAGTACTC
GTTTTTCAGTATTTGAGGTTTGGAATCTAGGCAAGAAATCATAGACATACATTTGGCAAGAATATGTAAAAAATATTAACATCAGATCAAATCCTGAAAC
TTGAAGGTATTTCAAACTCATGCTCAATTATCTAATTTACCTTCTAATGATGCACTTAACAGAGAACGTGCCCTGAAGTGATATGTCCATCTAGCAATAA
TTGAATCTCACTGCACACTTGCTTCTCTTATTTCAATTCAGGAGCATATAGAGCAGGGCAAGGTGATACGGTATGATCAGGCAAGCCACTTATGAACTCG
TTAGCAGCCTGAAGACAGCCATGCAGCATTTTCTTCTCTAACCTTACAAGTCTAGTAGCAACTTCTTTCTTTGGTTCCAAACTGCCATCGGCCAACATTG
CTTCGTCCTCGTCCAAAGTAGTCGGATAACCAGCCAATCTTGATTTCAGGTAGACAACAAGTTGGTCAAGTACAGCTCGCTCTGAGCATGGACTAACTGG
ACATGTATCACCTTCTGACGAAAGTATACATTGCATTTCATCTGGATCTGAAATGTATCCTAGTCTCAAGTATGGCAGCATTTCAGAAATAGTTTCCTTC
TCTTTGCCTACACAGACTTGGAATTTTTGGATAGCAAGCTTTCCATTTCTTTGAGCGACCATTCTCTTCTCTTGGTATTGAGGATCTTCAGTGTTTAGGG
ATGCCTCGATTGCTATGCGATCATATGGATTGTCTTCATCAACAAAACCATAATTGAGAAGCAACCTGGAGTTTGGTTGAGGCCCACACCAAACAATTAT
TGGTTCTCCTGCTTTGTACGGCCGATCGACCAGCAATCGAACAGAACCATCAACAGCAGTCAGCATTGCTTTGCAGTTGCTCTTGTACGTCAACAGTGGT
GGGCCCAAGGGAACTAGTGCAAATCTTCGAGCTAAACTAACCTTCTGCAAATGAACCACACAAGACTGTACTGCAACAAATGCCTGCTTGAAGATCTCAA
ACGGAAACGCCTCAGTAGGTACATCAAAAGGGTATTGCTTAAACAATGAACCTGCCATGAACCACAATGTGTCAAGCTCATTATACTCTCTTCTTATTCC
CTCATCTCTAACAACAACTTCATCCCTCATGGGGCTGCCATTCAGGTAATCCAGTTCACTTTCAATCCATAAAAGAGGTGATTCAACAGCTAGTTGCCCC
CTGCCTCGCTGACGATCAAGTTCTTTAATATACGGGTACCAAAGTGAATCTCTTCCTTGCTTCTTCTCATACATCAGATACAATGCCAAGCATGCCAGCT
CAGACAATTTGTTTGTTGTTAACAATTCAGCGACCGACTCGTCGCCGAGAACCCGCTCCAGTGTGACAACGAGCGACATGGGCACCTCGAACGCCACATC
CCCCGCCTCGAGGTCCTGCCCAGCAGCGACGAAGTGTAATGGCCGGTCTTTGCCCCCGCGAGAGCACGGGACGGGGCGCTCCAGGATGGCCACCTTGCCC
GGC
page-top