Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20949  (registered. 2007)
Contig Information
Length 1403 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_000549 [Oryza sativa (japonica cultivar-group)]
Score 1210
Evalue 1.163e-130
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20949
TCGCCGCGGTCGCTCTTTTCTTTCTTTCCGTCCCACGTCTAAAACTCTACAGCTCCAGTTGTATATTACCGCCCGATTGGATCTGCCTCCCTCCCGATTC
ATCGTCTCCCGTCCCCTCTTTGTCGTCCTCTTCACCAGCGGCAGGCGGTGGTGGCAGGTGACTGTGACTAGCAGGAGCGCGGAGGAGGGGTCCTTCGGTC
GCCATGGCTCAGATCTTGCTCCATGGGAACCTCCACGTCACCATCTTCGAGGCCTCCTCGCTCTCCCACCCCGGCCGCGCCAGCGGCGGCGCCCCCAAGT
TCATCCGCAAGTTTGTAGAGGGCATTGAGGAAACTGTCGGTGTTGGCAAAGGAAGCTCCAAGCTATATGCCACCATTGATCTCGAGAAAGCTCGTGTTGG
GCGTACCAGGATGTTGGGCAACGAGCCCGTCAATCCTCGCTGGTACGAGTCGTTCCACATCTACTGTGCGCACCTTGCCGCCGATGTGATCTTCACGCTG
AAGGCCGACAACGCGATCGGGGCGACGCTCATTGGGAGGGCGTACCTGCCTGTCGGAGAGCTCCTGGAAGGGGAGGAGATCGATAGGTGGCTTGAAATCT
GTGATGACAACCGGGAGCCTGTTGGTGAGAGCAAGATCCATGTGAAGCTTCAGTACTTTGGCGTTGAGAAGGACCGCAACTGGGCGAGGGGTGTCCGGAG
CGTCAAGTTTCCTGGTGTTCCTTACACCTTCTTCTCGCAGAGGCAAGGATGCAATGTTAGATTGTACCAAGATGCTCATGTCCCAGACAACTTTATCCCC
AAGATTCCGCTTGCGGACGGCAAGAACTATGAGCCTGCCAGATGTTGGGAGGATATCTTTGATGCCATAAGCAATGCTCAGCATTTGATTTACATCACTG
GTTGGTCTGTGCACACTGAGATCACCTTGATTAGGGACACCAATCGCCCCAAACCTGGAGGAGACGTCACCTTCGCTGGCCTTCCTCTTGAGTAACTCTC
GGGACAACCACTGGATCTTCTGGGTCGGCCCGTTCGTGGGAGCGCTGGCGGCGGCGGCGTACCACCAGTACATCCTCCGGGCGGCGGCCATCAAGGCGCT
CGGCTCCTTCCGGAGCAGCCGGAGCAACTGAGCCGGCCGGCCAATAATTTAATGCAACGGTCACCCACCGCGCTAGCCAGCCACACAAGCTAGCGTGTCC
ATCCGGCCTCGTCGTTCAGTGTCTGTGCATGCATGTGAGTGAGAGGAAGGCCAGCATGCGTGATTCGTGGCGCGTTTTCACCCTTCAATTATTACTCCCT
GTCACCGTTAATGTTGTCGAATTATATTAGTTACCGTTAGTGTTGGTGTTGATGGATGATGAACCTGTAATGTAAAANCCCGCCTGTGAGTGACCAACTG
CTG
page-top