Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11608  (registered. 2012)
Contig Information
Length 876 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 4
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig11608
TTTTTTTTTTGAACAGTGAAGGGCCTCGAAGGACCCAGAACTTCATTATTCAAAGCAGTGCGCAGCACATCTTACAAACAGGACTCCAAAGAAACTGAAA
ATTACAGGCAAGTCCCTGATACTTATGAAAAGGACTTCGAAACTGGAAGGAAAAAGCGACCGGGTCCAAACTGCTCTCCAGTGGATCCAATCATCGCCGG
CGCCGGGGACGAACCACTTGGTCCGGCGAGACCTCTGCGGCTGCACCACAGACTCCACTTCAAGCAGCACTGCCTCCCTTGTTGGCATCAAGCCCTGGAG
GAATAAAACTAGCCGCCATTCAGCCTGAAGATTCAGCAGATCGTTAGAGAAGGCCGGCCAGCCATGGAGGGCGCTGTAGCTTCTCTGAATCCACTGCTGA
TTGTGCTCAGGATCCCCATCGTCTGCCTCCAGATTCACACCGGAAGCCCTTCTCTCGATCAGGGAACGACACCACCCTCGTCGGAAGCTCCGCCACCGCG
ACGGTAGGAAGCGAGAGAATAACCACAGAGGTTTGATCCAGTGGCCCAACAAGCTTATTATGGGGGGATTCGCCAGATCCGGCTCCTTCCTTAGGCCTCC
ACCATGGAGGCAGAGCAGAAGGCTCCAACGGCGACCACCAGAAGCTGCTTGCAAGCTCCGGTGACCAACTCCCCGACGGCATGACGCCAATCCACGGCAC
AAGGCCAAACACCACTAAAACGGCAAACCTACACCTACTACTACTATAGACATGAGCAGCCCAAGCTCCCCTCTCATCCCCACTCCAAGCAGCGGCGCCG
CCGGAGGAGAAAGAGAGAGGAGCCGGGGAAACCAAGGGGACTCTCAACGGGGAGGAGGAGGAAGAGAGAGAAAGAG
page-top