Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20785  (registered. 2007)
Contig Information
Length 700 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 3
Wh_VABA Shoot with ABA treatment 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: hypothetical protein [Pan troglodytes]
Score 96
Evalue 0.0563111
Total Hit Count 144
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20785
TTTTTTTTTTGCCTGTGCTAAAATTTCAAATCTCTATTAATAGTCCCACCCTGCTCTTTTACATGAAATCTTACAAACTTATATACGTTCATGCGTTGCA
AGATCAACAAGCCAACAAAGAGAGGATGAGAGGTGCCTGTCGCATGTATTATGCGTCACCAATCGAAATGAACAAAAAGAGGAGAGGCGCATAATGGAAA
GAAAGGTCTCAGTTAAATTGCCATTTGAGCTAATAATCCTAAAGAAGGAGAGAGAGCCTTGGATGTCTATGGTACAGTCATGTGGGAGCTTTCACCGGAG
GCAACTTCGACACTCCCACATCCGCGCCTACCGGCAGACGAGCAACACCACCCTGCCTACCGCGCCTCCGCCACAGCCCCCGCGCGCTGGCATGGCATAT
GGTCGGCCGCCAGATCTGGCGAGCAACCGAGCCACTGCACACCGGCTCCGTTGCCTGCAGCCACAATCGGGGTGAGCTACACCACCACGGCACGGGGACT
CCGCCCTTGTCCCGGTGCACCGACGAGCACGCTGTCACCGCCCCAGCTGTTGCAGCAAACACGTCGGCGCTGCCAGCCAGGAAGTGGCTGCCTAGCCACC
GTGGGCGAGAAGAGGAGAGCAGCGCTTGGCTGGTGTTAGTGGATGGAGAAGAGAAGGACGAGCTACTTTGGGCGATGAAGTAGCATGAGGAGGAAGATGG
page-top