Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11590  (registered. 2012)
Contig Information
Length 1792 bp
Clones alternative view 131 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_SH - 2
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 13
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 7
Wh_VABA Shoot with ABA treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_SP 3
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XE Seedling, infected with leaf rust 30
WH_XF Seedling, infected with leaf rust 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|111073715|dbj|BAF02546.1|| triticain alpha [Triticum aestivum]
Score 954
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11590
TTTTTTTTTTAATACTGCAATCTGCTTATCATGTTTCTTGATGAATTCCATAATAACAATGGCAGCTCCAAACTGTGAGGGAATGAGCTGAGTTTTACAT
ATACATATGCAAAAGCAAATTTGGTGGTTCTGTAAACGACCGAACCCGATTTTAGGATTATGTACAGGAGCATCTATTATAAAGAAGATACTAGAGAGCA
TAGCTATCGCCATGCTGCGCCTTCGATTGTGGATCACCAGGTGATCATTTGCAGAAGTTAATCACCATGGCCGTTGGCTGTACGAATGTCGTGATGCAAA
TGTTTACGCGCTGCTCTTCTTGCCGTCAGTTGCAATGCCAGAGAAAGCACCGATAGGCTTGGCCAGGGTACGCCTCTGAGCCTTCACTGACAGTGGGCTG
TCCTTGGCCGCGAGGCAGGTTCCCTGCTGGGTGTTGCAGATGGGATAGTTATGAGGGCAGCAGCTGTAGTGATCATCGCAGCAGGTAGCACCCTCAAGTG
GGCAACAGCCCCAGGCGAAGCACTCCTTGCCGTACTCGTAGATGCAGCAGCAGGTCGTGCTGGCGGGGCACTCGTTGTAGCTGTCACAGACCGAAGACGG
TGGGGCGGGAGACGGCGGGGTTGGGCCGGGGTTAGGAGGGTTCTCGCCCGTCTTCGTCGGGTAGGAAGGCTCGACGGCAATACCACATTTGCCACTGGAT
GCCTTGATGTTACGCTCCATCCGGATGTAACCATCCTCTCCCCAGACGGTACCCCAGGAGTTCCTGACGAGCCAGTAGTCCTTGCCGTTCTCTGTACCAT
AACCAACGGCGGCGACACCATGGTCAAGTGCTGTTCCACAGGTTCCGGTGAAGATACCCGATTTGTAGAGCTGGAATGCCCTGCCACCAGCCTCAATCGC
AACACTGATGGGCTGGTTTGCAACTGCCTTCTGCAGACTCTTCTCACTGTTCACGGGCACATCCTCGTACCCATCAATGGTAACAACCTTCGCATTTTTC
TTGTTAGCATCGCAACGGTTGTCCCTCTCCTTGTAGGGGTAGTCCTCCTCAGAGTCGATACCACCATTGTTAATGATGAACTCAAACGCATAGTCCATCA
GACCTCCATTGCATCCCTCGTTGTATGAAGTGTCACAGTCAACAAGCTCTTGCTCGGACAGAGGGATCATGTCGCCTGTAACAATCTGGTTGATGCCTTC
AACAGCTGCTATTGCTGAGAAAGCCCAGCAGCTTCCACAGCCGCCCTGGTCCTTGATGGCAGCAACGGCCCCCTTCTTCCTCCAGTCGACGGTCTCCGGC
AGCTCCTCGTTGTCGTCGGCCTGGTACCTGGCGCTGAGCTTCCGCTCCCGGTCCGGCTTGGTCCGGGCGCCGAGGTAGGTGCTGCGGTACTCCTCGTTGG
TGAGGTCGGCGAAGCGGTTGAGGCCGAGGCGGAAGGAGTGGAGCCCGGCGTCGGCGGCGGCGTTGTGCTGGTCGATGTAGCGGAGGTTGTCCCGGAACAC
CTCGAAGCGGCGCTCCTCCTCGCCGATGGCGTTGTACGTCCTGCGGTGCTCGGACATCCACTCGGCGTACATCCGCCGCACCTCCTCCTCGCTCCGCTCC
CCGTACGACACGATCGACATGTCCGCCGCCGCCGCCAGCGACACCAGCAGCAGCAGCGCCGCCGCGGCCGCCAGCAGAGCCATGGAGCTCCTCATCGTCG
ACACCACAAGTACACCACCGAGCAGGAAGAGAGATGGGGGAGCAGTAGATGGGATTGGGTAGCAGACTTCTTGCTTTTGTTCTCCATGGACG
page-top