Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20750  (registered. 2007)
Contig Information
Length 1200 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 1815
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20750
TATGTCATGAACAAATTCTTACAACTTGAAACCCCCTGAATCAACACTTTATCTCGCTTGCAAAACTTGTACAAAATAAGCAAGTCAAATATGAACCGCC
CCAAAAGTGCAATGCGTGCGAGCCATTGACAGCTAAGGTCAATCAGCACTGTACTCCACACGGCTTAAGGATGGGCCCCTTGGGCTTGGCAATGAAGGGG
TCGATCCTGACCCACACAAGGGAGAAGATGGAGGCGAGCAGGACAGACCAGAGCACGACGATGGTGGGCGTCCGGTTCTGCCTCCCCATGAGCCCCTTGA
GGAACGGGTAGAGGTGGACGATGACCCAGAAGGAGAAGAAGAGCTTCCCGAAGAGCGGGCCCCAGGACCCGTAGCCGTTGTTGACGGCGTCGGAGACGCC
GGCGACGATGCCGACCATGTTGATGATGATGAGCGTGGTGGGTGGGATCAGCAGGGTCGTCCACTTGAAGAGGTAGAGGTCGCCGAAGGCGTCGGCCTCG
TCGGCGCCCGCCTTGGAGGTGACGGTGAAGTTGGTGTCCACGCCGCCCAGCACCTTGAGGAAGCCCTGGAAGACGGCGAACAGATGCGCCGACACGCCGC
CGATGACCCAGAACTGCTCGTTACGCCACCAGTCCTCGATGCTCACCCCGCTCCACCGCAGCTCCAGCACCCCCGTCGCGATGATGGACATGAACAGGGC
GATGAACCAGATGCTCGCCAGGTTGTTGAGCGTGGGGATGATGAACTTGCCGGTGAGGAGGCAGACGGCGGGGATGGTGCAGTAGGCGATGAGGGGAATG
GAGGTGAAGGGGTAGACGATGGTGTTGGTGTAGGCGAAGCGCTCGAGCCACTTGAGACGGCCGCCGTAGGCGTACCAGAGCGGGCAGTGGCGACTCATGA
AGATCTCGACGGAGCCGAGCGCCCACCGGAGCACCTGGTGAAGCCTGTCCGACAAGTTGATGGGCGCCGACCCCTTGAACGCTGGGCGCGTGGGCGTGCA
GTAGACGGACTTCCACCCACGGCAGTGCATCTTGAACCCCGTCAGGATGTCCTCTGTCACTGACCCGTAGATCCACCCAATCTCTTTGCCCCACTCGGTC
TTCTCCTCGTACCCGCAGCTGATGACGTGGATGGCCTCCTTGATGAGGCCGGCGGGGTCGGCGGCGGCGCCCTGCGGCAATCCGCCGTCCTCGACGAGCG
page-top