Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20647  (registered. 2007)
Contig Information
Length 1006 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0497000 [Oryza sativa (japonica cultivar-group)] >gi|113631790|dbj|BAF25471.1| Os09g0497000 [Oryza sativa (japonica cultivar-group)] >gi|125606201|gb|EAZ45237.1| hypothetical protein OsJ_028720 [Oryza sativa (japonica cultivar-group)]
Score 1015
Evalue 2.9557e-108
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20647
CGCATTATTCCCACTCAAGCAATTGAGCTTGGAACATTTGAGTATGTCAAAAGGGGCATGAAGTCAGCACAAGAGAAATGGAAAGAGGATGGATGCCCAA
AGCTACAGCTTGGTAAGATGAAAATCGATATTCCACTCCACTTGTTATCTCCAGTTGCTATTGCTGGTGCGGCTGCTGGAATTGCTGGTACATTGATGTG
CCATCCTCTTGAAGTAATTAAGGATCGCCTGACCGTGGATCGAGTGACTTATCCTAGCATTAGCATTGCCTTCAGCAAGATATATCGAACTGAAGGTATC
AGAGGTCTCTATTCTGGCCTCTTCCCGACACTAATTGGCATGCTTCCTTACAGCACATGCTACTACTTTATGTACGACACAATCAAGACCTCATACTGCC
GCCTACATAAGAAGAAATCCTTGAGCCGTCCTGAGCTACTCATTATCGGAGCTCTGACAGGTCTGACGGCGAGCACGATCAGCTTCCCCCTGGAGGTGGC
GAGGAAGCGGCTCATGGTAGGAGCCCTGCAGGGGAAGTGCCCGCCCAACATGGTGGCGGCCCTGTCAGAAGTGATCCGGGAGGAGGGCCTCCTGGGGATC
TACCGCGGGTGGGGGGCGAGCTGCCTCAAGGTGATGCCGAATTCGGGCATCACCTGGATGTTCTACGAGGCGTGGAAGGACATCCTCCTGGCCGAGAAGG
ACAAGCACCTCGACTAGCCGACGATGATGAAACAGCCCTTAGGCGACTGGGCCGAGGATGATGAGTTACTGAACAAACAAACAGTGCTAGGCGTTGTTGT
GGTAGAATAATGTTGTGTGGGGGGTTCTGATCCTTTCCCAGTTTTCGAATCCCCCACCTCTGCCTGTGCCGAACGGTTAGATAGGAGGGACGCGCCGGTG
CGATTGGGAGTGGAAGCATTTGTGTTTGCTGCTCCTTTGCTAACTTGGAATGCATGGTTGCGCATGGTACTATTCATTAACCATTTTCAGGATGGTTGAT
TACAGA
page-top