Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20643  (registered. 2007)
Contig Information
Length 731 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_KMP Shoot grown under continuous light 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit extensin [Hordeum vulgare]
Score 248
Evalue 6.10677e-20
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20643
CGCCGGCGCACAAGCCTGCACCTCCCATGTACAAAACACCAACCCAGCCTAAGCCCTCGCCGCCGGCGTACAAGCCTGCCCCCAAGGTCTCACCGCCGGC
CTACAAGCCTGCCCCCAAGGGTCTCACCGCCGGCGTACAAGCCAGCCCCCAAGGTCTCACCACCGGCGTACAAGCCCGCCCCCAAGGTCTCACCGCCGGC
GTACAAGCCAGCCCCCAAGGTCTCACCGCCGGCGTACAAGCCCGCCCCCAAGGTCTCACGTCCGGCGTACAAGCCTGTCCCCAAGCCCTCACCGCCGCCG
TCGCCAACTCCGCCGGCGCCGAAGCCGACTCCACCGCCCTACAAGCCCCCGACGCCTACTCCTCCGGCGTACAAGCCTCCCACCCCGAGCCCCCCGCCTC
CGCCGTACCACCACTAAGAAGATCCACCACTGTCAAGCTGGGAGCCTAGGATGCGGTCGAGAAGAGTTGTGCGAGCAGGCCAAGAAGAGCCACGTACGTA
CGGCGTCGTTGATCCTCCTGCGGTGTGTGAGTTGCTGCCGAGCTACTAGGGCCGATCTCTGAGGAGATGGAATAATGCAGATGGCTCCCATTAGTTATCT
TACCAGCTTATCGTTTGTGTTCGTCCAGTGTTAGCGTCTGTGTTGCTAGTGTCGCAATGTTGCCAGTGTCACTGTAAAACCATTAATCACCCCGGAAATG
GAAGTAAAAGGTGTTGTTTCCAAAAAAAAAA
page-top