Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11578  (registered. 2012)
Contig Information
Length 753 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XA Root 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|128185|sp|P27967.1|NIA1_HORVU|NIA1_HORVU RecName: Full=Nitrate reductase [NADH]; Short=NR
Score 280
Evalue 9.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11578
ATACTAGGTAGTGTGCATGAAGGAATAAACAGACCCTCAACCGAAGCCGCGTAAACCTCACATCCTTCCTGGGGCAAAACATCGGTATATGTCCAATGTA
CTCTAGGAAACAAGTGTACGTACGTACATACAACCTACAGAGTATAATTCATGCAATCACGTACGCATGCACGTACATACGGTTCTCTAATGAACAAATA
CGATCGACAGACACATATAAACATTGGGTACATGCACAGATTGATGCGTCGACGCGGTGGTATTTACGTAGCTTAGGCAGCTGCATGCATGCTACGTACT
AGAGGAGGAGACATGATGTTGTTTCATCAGAAGGAGATGAAGGAATTGGCCATGTCGTACTTCATCTTCTCCAGGTTGGGCGAGATGGCGAACTTGATCA
TGGGCGGCGGCCCGCAGGCGAGCGCGAGGGTTTCGTCGCCGCCCTCGGGGACGTGCGCCCGCAGGATGTCCTCCGTCACGAACCCGACGCTGAACCTCCA
CCCGTCCTCGGGCCGCTTCACCTGGTCGATCACGTACCACACCTTGAGCCTCTCCGGGTACTCCGCCGCCCACCGGTCCAGCTCGTCGCGCAGCAGGATG
TCGTCCTCGCTCCGGTTCGCGTACACGAGGTGCATCTCCGTCTCGTCCTCCGGCTGGTCCCGCAGCACGGCCTGGATCACCTGGTACATGGGCGTGATCC
CGCTGCCGCNNNNNATCATGGCCAGCCGCCGCGCCCGCCGCTGCTTGCCGTTG
page-top