Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20608  (registered. 2007)
Contig Information
Length 994 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010136 [Oryza sativa (japonica cultivar-group)]
Score 160
Evalue 4.02534e-09
Total Hit Count 6
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20608
TTTTTTTTTTGACTCAAAACATCAGTATTTCAACATTCAAAGATCCATTTGGTAGCATCCAACTACATCGGTAAACAGAATTTACATAAGACAATAAGAT
TTCTTTTGTTCAAAACTAAGATAAACAAATGGTTTGAGCTTGACGCACAGCTACAGCCATGTTCAGGAAGACAAATTGCTCGTTCGCAGCCGTTTGTTGG
ATGGCTTTATTAGATGTCTTGTGAATAACTGACTCGCCACCATCCTGTGAAACTGCATCCTTCAAAGAGGGCCACATGTCTCTCGCAGAAGAGTCACCAA
ACTTGCAATGTTTTGAAGATCACAGCTTAACCTCGCCCCACATGATTCTGTTGTTGCTATGAATACAAGAAACATCATGTGGGCATCCTAGTTGACTGGT
CCAACTACTATCATGTAGTAGAAGTTCTGTAGCATTCTAACAATCTCCTCCTCGTGACAAAACTTACAAGCTTGAGACAAAACTTGTTGAACTCGTTTCA
GTGATGGAACTACCAACACAGGTTTGCTGATCTGACTACTCAATACTGTCGGCATCTTTTGGTTCCTAGTTGCTCACCCCGTGTCGCTCGCATAGGCAAC
ACCAGTGCGCACAACCCTAGCCACCGCAGGACCTCGGCATCTTTCTCTTTTTCTTTGGTAGCTTGCGGGTTGGGGTGAGGAAGTAGAGGAGACCGGGATG
TAGTCGACGCGGCACTGCTCGTGTGAAAGAACGCAGAAGCGGCATCTGCTCGGGGGAGAGGATGTAGTCGGCGCTCTTGGGGGAGAGGACGAAGACGTGG
CGGGACGGAGCTTCTGGAAACAGCGACGCTGCCCGTGCCAGGAGCTCCTGGAAGCAGCGACGCTTCTCGGGCTGGATCTCCTGGAAGCGACGGCGCTGCT
CGATGGAGGATCTCCAGGGAGCGGCGGGGCTGGTGGCGAATGGTCGTCGGGGCGGCGGAGGGTGCTCGGGGGAGTGGTCTGGGAGGGATGGCAC
page-top