Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20601  (registered. 2007)
Contig Information
Length 1734 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glucosyl transferase [Sporobolus stapfianus]
Score 1202
Evalue 1.29596e-129
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20601
AAAGTGGTAAAGCAGTCAATCAATTCCAGTTCTGGGCAACAGGATCATCAAAAAATTACAAGTTTTATTCTACCCAAATTCGGATCTATTCAGCTTTGGC
CGGCTTGGCTTTGATCTGGCCGGCCCATAGGCCATCTTGCAAGTACAGTAATGTGAGGAGCAGCAACTTGAAGATCTTATCATTTCTGGTCGACCAGATA
CCCCAGCATTCCATAATAACAATGTCCAAGGCAATGTCCTATGGAAGCTGAAGTAGTGCAAGTTGAATGTCATCAAACACTGAGATTCCTCTGTTTCTAT
TTGGGATAATACGGTCCTAGCACTGAAGAGCAAAATGGCAATTCCAGAAGAGGTGCAACAAAGTTTCTTCTGTGTCATCCACACAGATTGGACAGTTATA
GTTGTCCAAGTGCATAATCTTTCGGTGAAGGAGGTTTCTGGTATTAACCTTATCATGAATGAGCAGCCAAAAAGAGATCTTGTGTCTCAATCTGCAGGTG
GTTTTCCATGTCTTTGAATGAAGTATGAGCATTGTTAATTCCCATCATGTGCTTATACATCTGCATGGAAGAATATCCTCTGGGTTTTGTGCGTCTGCAG
TGTGTTTCTAAAAAGAAAATCCAGCATTAAGTAGGTTTACAAGCTTCACATCCACGTCTTTTAGGAATTGGGCAAACGCCAAGTTGGACGAGCCCCCTTC
CTGGAGCGCCTCAGCCGCCGCATCCTTCACTGCCGCTACCCGCACCCTGAGTGCCGTGCCTCCCTCGGACGCCATAACCCATCTGACCTTCTCCTCCACC
TCCTCAGCCTTAACCACCTCTTCATTGTAGCCTCTCATCTCCACCCCAAGCTTCATTCCCTCCACTATGTGCACCTTGTTCACCTTCTGCTCCGCGTACA
GCGGCCAGCACAGCAGCGGCAACCCTGCCGTGATGCCCTCCAGTGTCGAGTTCCAGCCGCAGTGCGTCATGAATGCGCCGGTTGCCCTGTGACGCAGGAC
CTCCACCTGCGGCGCCCAAGACTTCACCACGAGCCCTCTGTCCTTGGTCTTCTCCAAGAACCCTTCCGGCATGAGCGCCTCGAGGTCAGGCTCCGGCAGC
GGATCCCCGTGCTTCTGGTCGGGACTGCGCGGGCTCCGCACAACCCACAGGAACCTCTCCCCTGACTTCTCCAGACCAACTGCAATTTCCTCGAGCTGCT
TACTGGTGAATGTGCCCAGGCTGCCGAAGGAGAGGAACACCACGCTCTGGTCCGGCTGCGCGTCCAGCCAGCGGAGGCACTCGTGCTCCTTGTCTCCGCC
TCCGGAGACCAACGGCCCGATGCAGTAGACCGGCGGCGTCGCACGACCAGGGACGCAAAGTCCTTCGCTGAGAGCGCTCAGTGCGGGCTTTTCCAGCGAG
TCGAAGGAATTTGTAAGAATTCCTTTCGCCTCCGCCATTCGCTGAAACATGCGTAAGACGTACACGAGTGCTTCATCGTCGGCGATAACTTCGGACGGCA
GCTCCGAAGCCTTGAAAGGAGGAACACCCGGGAAGGTGATGATGGAGTCGCCGAGCTCTTTTACCTTGGCCGTATTGCTGGCGAACTTGCTCGGCAGGTT
GAGGAAGATGGCGAGGTCGCCGGCAGCGGAGGCGAACGAGTAGTAGACCGGCAGCTTGAGCTCGGCTGCGACGTCCTGGGCGTCGACGCAGAACATGTCG
AGGACGAGCGCGTGGACGGCGGGCAGCGAGCGAG
page-top