Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11574  (registered. 2012)
Contig Information
Length 1536 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_SP 1
WH_XE Seedling, infected with leaf rust 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|13195734|gb|AAK01174.2|AF314182_1|AF314182_1 triose phosphate translocator [Triticum aestivum]
Score 571
Evalue 1.00E-160
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11574
TCGCTGCGCTCCCCATACGACACGATCGACATGTCCGCCGCCGCCGCCAGCGACACCAGCAGCAGCAGCGCCGCCGCGGCCGCCAGCAGAGCCATGGAGC
GCCTCATCGTCGACACCACAAGTACACCGCCGAGCAGGAAGAGAGATGGGGGAGCAGTAGATGGGTTCAAACATGGCCAGCTCCTATAGTGTGACGGGCG
GTGTGTACAAGGCCCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCGATTCCTGCTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAA
CTGAGGACGGGTTTTTGGAGTTAGCTCACCCTCGCGAGATCGCGACCCTTTGTCCCGCCCATTGTAGCACGTGTGTCGCCCAGGGCATAAGGGGCATGAT
GACTTGGCCTCATCCTCTCCTTCCTCCGGCTTAACACCGGCGGTCTGTTCAGGGTTCCAAACTCATAGTGGCAACTAAACACGAGGGTTGCGCTCGTTGC
GAGACTTAACCCAACACCTTACGGCACGAGCTGACGACAGCCATGCACCACCTGTGTCCGCGTTCCCGAGGGCACCCCTCTCTTTCAAGAGGATTCGCGG
CATGTCAAGCCCTGGTAAGGTCAACGCGATCGCCCCAGGCCTCCCCGCGCTGCTGCAGCAATGCCGGCCCTCGGGACGCTCTCCGCCGGCGGCGCCGCCG
CCGGCGTCGCAGGCCTGCTCCGCCTCCGCCGCGGCCCCGCCCTCGCCTCGCCCCTGCCGGCCGCCGCCCGCGCTGGCGCCGTCCACGACGGCGCCCAGCT
CGTCTGGGGCCGCCAGCTCCGCCCGGCCCTTGTCCTCCCCGCCGGCCTGCTCCCGCTCCAGGCCTCCAAGAGGCTCACGCTCCGCCCGCCCGCCGCCTCC
GCCGAGCCCGCCGGGGAGGCCAAGTCGCCAGGGTTGCTGGAGAAGTACCCTGCAATCACCACCGGCTTCTTCTTCTTCATGTGGTACTTCCTGAACGTCA
TATTCAACATCCTCAACAAGAAGATCTACAACTACTTCCCCTACCCATACTTTGTTTCGGTGATCCATCTACTTGTGGGAGTTGTGTACTGCCTCCTCAG
CTGGGCCGTTGGTCTCCCGAAGCGTGCGCCTATCAATGCAACGCTCCTGAAGCTGCTCTTTCCGGTGGCATTGTGCCATGCTCTTGGTCATGTCACAAGC
AACGTGTCCTTTGCTACTGTTGCAGTCTCGTTTGCCCACACTATTAAAGCTTTGGAGCCCTTCTTCAATGCAGCTGCTACCCAGTTTGTCCTTGGACAGA
CAGTTCCCTTGTCTCTGTGGTTGTCTCTTGCCCCTGTTGTGCTTGGTGTTTCAATGGCATCCCTCACTGAACTGTCATTTAGCTGGAAGGGTTTCATCAA
TGCTATGATCTCTAACATCTCGTTCACTTACCGGAGTATTTATTCCAAGAAAGCCATGACTGACATGGATAGCACCAACGTGTATGCTTACATCTCAANN
NNNNCTCTAGTTGTCTGCATACCACCTGCACTTATT
page-top