Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20573  (registered. 2007)
Contig Information
Length 832 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0162500 [Oryza sativa (japonica cultivar-group)] >gi|49389256|dbj|BAD25218.1| putative ribosomal protein S14 [Oryza sativa Japonica Group] >gi|113535513|dbj|BAF07896.1| Os02g0162500 [Oryza sativa (japonica cultivar-group)] >gi|215765139|dbj|BAG86836.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768151|dbj|BAH00380.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218190118|gb|EEC72545.1| hypothetical protein OsI_05960 [Oryza sativa Indica Group]
Score 607
Evalue 4.38963e-61
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20573
TTTTTTTTTTGTTCCTGAATGAGATCGTTGGCATTCCAGCAGTATTACTTATCAGAAACCATAATAAAGGCATGTGCGGACTAATACTTTGGCATAAATA
CACGACCAGAGATGATCTGAAGTGAAGCACAGCTCTGAATTAAGCGACAGTCAAATATTCTGAACTCAGAGTAAACTGACGGGCGACTACATAGGATCTA
TAATAAGGCTACTCAAACTGCAAATTCTTGATGACGACCATGAGAGACGATGAAAAAGAAGGTGTCTACAGCCTCCTTCCTCTCCTGCCGCCCTTTCTGC
GAGTGCTGTCAGTGGGAACAGGGGTCACGTCCTCAATGCGTCCAATTTTCATGCCAGAACGAGCGAGTGCCCTGAGAGCGGATTGAGCACCAGGTCCAGG
AGTCTTGGTCTTGTTGCCTCCAGTGGCACGGAGCTTAATGTGCAAAGCAGTGATGCCAAGTTCCTTGCAACGCGTCGCAACATCTTGAGAAGCGAGCATA
GCTGCATATGGTGATGACTCATCACGATCAGCCTTGACCTTCATTCCACCAGTAATACGAACAAGGGTCTCTCTCCCAGACAAGTCAGTGACGTGGATGA
ATGTGTCATTGAATGATGCAAAGACATGAGCAACTCCGAAGACATGCTCCCCTTCACGGACAGCAGGTCCAAGAGTAACATTCTCCTCCTTAGGCTCCCT
GGTTTTCCTCTTCGACATGGTGGGGCGAGGCAACGAGGGATCGACGCGTCTTCTCCTTCTGCTTCAGGTCGCGAGCTCGCCGCCGCCGCCGGAAATTCGT
GAAGAGAGATAAAGGAATTAGCGGGAGAGGTT
page-top