Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20566  (registered. 2007)
Contig Information
Length 859 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit succinyl-CoA ligase beta-chain [Zea mays]
Score 915
Evalue 8.99738e-97
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20566
CGGGCAAACAGGTAAATCCTACTTGAACTTCATAACAGTGGCTGCTCAATTTTGTGCCCATATAGGTTTATTAACACAAAGATCACAAGTTTTAAGGAAA
ACTCAAAAGTGGAATCACTCCACTTCAAAAAAAATGCACTTCAAGATTACGGCCCCCAAAATCACTAAGAGAGCACCACTCCTCTTGTGCCAGTGAAAAC
AGAACTTTAGACTGATATGGTACAATCATTAATCATTTGACTGATGCTTTTACAGCCTTCTCTGCAGCATCATCAAGATCCTCTGCAGTGATCAATGTCA
TTCCACTCTCCTTAAGAATCCTTTTCCCTTGGTCTACATTGGTGCCTTCTAGCCGAACAACAACAGGGACCTTAAGATCAACCTGTTTAGCTGCATTCAC
TATTCCACTTGCTATCACGTCACATTTCATGATACCTCCAAAAATGTTCACTAGAATTGCCTTCACTCTATCGTCTGAAGTCAATATCTTAAATGCTTCC
ACAACCTGTCCCTCGGATGCACTACCACCAACATCAAGAAAATTGGCAGGTGTACCACCATGCAGCTTAATGATGTCCATCGTAGCCATTGCCAATCCTG
CACCATTCACCATGCAACCAATCTCTCCATCAAGCCCGATGTAGTTCAAATCTGCTTTAGCAGCAGCCACCTCTCTGGGGTCCTCCTGTGTTGTATCACG
CAGTGCAAATATTTCTTTCTGCCTAAACGCAGCATTATCATCGAAGTTCAACTTTGCATCAGCAGCAACTAGCTTTTTATCAGCTGTCTCAGCAAGAGGA
TTTATCTCCAGCATTGTGCAGTCGGTCTTGCAGAAAAGTTCATATAGCTTCTTAATCTG
page-top