Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20560  (registered. 2007)
Contig Information
Length 1004 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_RDr Root of dessiccated seed 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38200 [Oryza sativa Indica Group]
Score 1398
Evalue 1.1405e-152
Total Hit Count 280
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20560
ATTTCTGAGAGCTCAGCACATCTTCAGGTTTTCCTTCTACCAAAGCCATGGGTTCAGGTCTCTTCAAGCCTAGTGTTCATCCGGACCTCCGTGATGTTTT
CTCTAAGATGTCTTTGGGTGACAAGATTGGCTTTCTATTCATTCATGCATTTGACAAGAGAAACTTGTGGCACAAGATGCCTGTTCTGATCGGTTTACTC
TACCTAAACACCCGCCGGACCCTCCTCGAGAAATACAACCTGCTAGCTGTTGGGAGTTCTCATGGTACTCTGTTTGACCCCAAGGAGTTCCCGTACCGCA
CCGGAGATGGCAAGTACAACGACCCCCATAATGCTGAGGCTGGTAGCCAATACACCTTTTTTGGGAGAAACATGAAACCAGTTGATCAACAGGATGAGTT
GATGAGCCCAGATCCATTTGTTGTGGCGACAAAGCTGTTAGCCAGGCGAGAATACAAGGACACAGGGAAGCAGTTCAATATACTAGCAGCTGCATGGATA
CAGTTCATGGTTCATGACTGGATGGATCATATGGAGGATACCAAACAGATTGAAATCACTGCTCCAAAAGAAGTGGCCAATGAGTGCCCCCTCAAATCGT
TCAAGTTCTACGCCACAAAAGAACAGCCTACAAATTCTGATGGAATAAAGACTGGTTACAATAATGTCCGCACAGCTTGGTGGGATGGGAGTGCAGTATA
TGGTAATAATGAGAAACAGGCAAAAAAGATCAGGACTTATGTTGATGGAAAACTAGTCATAGGAGATGACGGTCTTCTTTTGCATGAGGAGAATGGTGTG
CCATTATCGGGCGACGTTCGCAACGGTTGGGTTGGGGTTTCNATCTTACAANCTCTTTTTGTTAAGGAACACAATGCANTTTGTGATGCANTANANGAAN
AACANCCCATCCTATCANATGAANAATTATATCNGNATGCCNNATTGNTCNCTTCTGCTGTCNTTGCNNANATTCNCNCTATTGATTGNCCTGNCNAGCT
TCTC
page-top