Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20559  (registered. 2007)
Contig Information
Length 1290 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit wpk4 protein kinase [Triticum aestivum]
Score 820
Evalue 1.73298e-85
Total Hit Count 385
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20559
AAGGGTGCATGCAATGCATGTTGCACCCAATTTATTCCTCAATCAGTTTGGTCCTTGAATTAACGATTACCCAAAATTATTCGGTTCTGCTGATAAACCA
ACAGCGGGAGTACATACACAATCATCATCAGCAAATTAAGTAGAGAAAAGTACAAACATTTAAACAGCAGCTAGGGTGACACCATATACAGCCACAATCT
AGCTCCCGTCTCGGATAACATTACGTATGCTCTCCAGAGTTAACCAAGTAACCGCGCTCATCATCGTCAGTGCCCGAGACTACAAGAACTCTTGCTCCTG
TCAGTTGCACCCGACTCCAGTTTCTTTCTAGCTTGGAGAGTCGCTCCCCCTATCCCCGTTAGCTCTAGGGGCGGTGGCGCCTGTTACCTTGAAGGCCTTT
CGGCCTACTCAGAAATGGTAGGTGTAATTGGAACTGGGGCCATCTGGTGCACAAGATGCTGCATTCCTGGCTTCAATTCCTTGTTGCAGAAATCATCATA
CTCTTCCTTATCCCCCGCCTTCTTTTTTACCTCCACTACTACAAGGGAGGGTGTGAGTTCAAATATCTCCGCGCAGATTGTTAGTGGCCCCTTAACCCCT
TCCCTTGTGCCCTCTAGGCTCACCCGCCAATCCTTCTTCCGCACCGCGAAGCTCTTCACATTTGCGATCTCCTCTAATTTCGTTATAATGCCCGACATAG
GTTCACTCGAGATGAATCTCACCTCGTCCCCTTTTTCCTCAAACAGCCCCGACAAGTTGAATCCCCTTGAGAATGATATGATATCAAACGCGTTAAGGCT
TGCGGGGCGTGGGAGTGGCCCGCGGAGCCTGTGGCGCTCTTCAAATGACGATGTGGCAGGGCAGGACACGACTGATGCGTCCGACTCTATGGGTTTCGGG
CAGAAGACAAATTTGTGAGGTATGCCAGAAACATCATGGAGGCAGCGGTGAACCTGGTGGCTGTAAACCTGTATAAGAATCCAGGGTGTGAGAAATGCAA
GCGCAGGCTTCCAAGTGGGTGGACGTTGACGGAGATGCTGTTGATTAGAGACAAAATCAGCAAGGGTATGTCGTCAAATGTTGGGGTTTGCTTCCCGAGT
TGACAGGCAACAATTAGTATGGATTGGAGGGAGTATCATCTCAAAATACACAGGTTCATTGTTGACGGTTAATCAGTGCATACAGCAGTAGCTTTGCAGC
GTGAGTGCGTTGTTTTGTCTAAGAAAAAAACTTGCTGTCAGCGACAATTAATATGAATCGGAGGGAGTACTAAGTTTTACAAAAAAAAAA
page-top