Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20555  (registered. 2007)
Contig Information
Length 1077 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_VABA Shoot with ABA treatment 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Chlamydomonas reinhardtii] >gi|158275807|gb|EDP01582.1| predicted protein [Chlamydomonas reinhardtii]
Score 94
Evalue 0.205073
Total Hit Count 27
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20555
TTAGGATGAACTGAGGTCAACCACATACATTTTTCTATAGCCGAGGGCTTAGATTGTAAACTACGATAACCATAGGGTTAAATTGTTGAAAAGAGTAAGT
TCGAGTACTAAACAGCAAAGTCCATTGGCCTAATGGCCCGGTTCTAAAATGCAGCAAGCCAGAGGGCTAAACGGCAGAGACCTGTTAAACTGTGGTTTAC
ACAGATATTTTAAGGGACTTATACTAGATTAGGCTCGAATCTAAGGGCTGAATTGAAAATCCACCAAAGAGATAAGAAATCCCCAATTTCTTCTCCCGTG
TGTGCTTCCTGGCCACTGGTAACTGCCGCCGCTCAGTGCGAACCGGCCGGTAGTTGCGCCACCGCCGCTGCTTGGGAAGCGAGGCCGTGTCGCACAGCGC
CTGAGGGCACCGCCATGCGCAGGAAACTGTGCCGCACCGGAGTACGTTGGCCGCCCACTCGCGTCGAGCGCCGATGATCTTCGGGTGCGGTTGCAGCGCC
TTAGGTGGTCGCTCGGACGAGCGCTGGAGGATGCCGCTGGGAAGGCCGGGGGCCTCTAGCCCCAGGTGCCCTCGTGCCAGGGGAAGCAGCGTCGGGCCGG
CGTTGAGAACTTCGGCGTGGAGGTTAGTGCGTCTTGTGTGCAAGAGCAAAAAGAATGGAATATGGTCACCTGATGATGTAGCAATTAAGATCGAGAGTTT
GGTGTTTGTATAAATTAATGCTTCATCGTCTTGGAGAAGGGGCGGCCCAGATCCTCGTTATTTTTCATGTGATCCCCTTTTCTCTTCTTCTGTTCTTGGC
CGAACTTGGTGTTTCGTCTGTGAGGACGATTTTTCTCCTCAATCCTCTGTCTTCTTTTTGGCAGTTATTGGTATGGATTTTCGATCGAGTGATCCTGGAT
GCCAACGCCCATATCCTTTTCTGTGCGTCTTCCTTGTGTAATTGAAAATTGTGCCCAATTTCAAGTTCTGATGTTCCTGCTTGGAGTATGATAAATCCGC
TCAATTGATTGATTTTCTGTCCTTTGGCAGAGTGTGTTCGAGGCTTCCAATTCTGAATCGATGGAGGCGGCGCTGCG
page-top