Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11565  (registered. 2012)
Contig Information
Length 1073 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VWD Shoot grown with dessication 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218187690|gb|EEC70117.1|| hypothetical protein OsI_00779 [Oryza sativa Indica Group]
Score 379
Evalue 3.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11565
TTTTTTTTTTCACCCCTTTTGTTATTATAGATAGTGTAGCATTCATACAAACCACAAGCCACTGGCATTTCAATTCACCGGTCTGCACCGGCAGCATCGT
AAGATGAGGATCACGGCAAAGAATACAATCAAGAACCAGACCAAAGCCATCATGCATGTCTTGCCATGCCATGAAGCCCATGGCTGCAATCCCATGGCTG
TGACTGGAGCGATCTGCACACGAGTGTTCAACTCCTCCCCCATCTTCAGACAACAGCTACCCTTCATACGGCCTGCAGGCCGAGCGTCCGGTCCATCCAC
CCGATGATGTCGGCGGCGATCTCGTCGCGCTCGGGCTCGAAGAGCAGGTCGTGGAGGAACCCCTCGTACAGACGCAGGTCCTTGTGCCTCGACGCGGCCT
CCGTGTAGAGCTCCCGCGAGGCCAGCGGGTCCGTCACACGGTCCGCCGTGCCGTGCAGGACCACGAACGGGACCGTCACCTTCTTCAGGTTGTGCAGCAG
GTAGGAGGAGATGCGCAGGATCTCGTGGCCCGTACGGACCCTGATCGGCCCCGTGTAGACCAGCGGGTCAGAGTACTTCGCTAGCAGTGCGGCGGGGTCG
CGCGACACCGGGATGCCGCGCTTGTTGGCTCCCTTGAATTGGAACTTGGGTGCTATCAGAGAGAATATCGGTGCCACGGCCCCAACTATCGGATGCGCTG
GTTTTACACGCACAGCTGGTGAAGTCAGGATGATTCCTTCCAGTCTGGTTCTGATATGGGCGTACAGCGACGCCATTTCAACCAGGCTATTTTGTTAATG
CTTTGCACCATTCTCCGCCGTCAGGGTATCCATTGTTCACAGGCCCAGAGGAGTAGGGTCAGTGTCTAGATCTGGCCTAAATACCGATGAGAAAAAGCAA
TTTAATTCGACAAGCCATACCTTCAAAACAACAGCTCCACCAGTGGAGTGACCGAGTAGAAAACAAGGAACATCTGGATTCTCCAGCATAATTTTATCAA
GAAGTACTTCCATGTCTTCTATGACATAATCGAGAGAAGGAACATAACCGTGCAGACCATCACTGCCACCATG
page-top