Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20471  (registered. 2007)
Contig Information
Length 966 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_031265 [Oryza sativa (japonica cultivar-group)]
Score 807
Evalue 3.63455e-84
Total Hit Count 248
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20471
TGTTGCTTCAAAATAATGTCCTTCTCACAGCAAGGACCTCGCACAGTTTGCATTCTTTCAGCAAATGGTGCAATAAGTAATGTAACACTTCGGCAGCCAG
CTACATCTGGTGGACTGGTGACTTATGAGGGTCGATTTGAGATCATCTCCCTATCTGGTTCATTCCTGCTTGCAGAAGATGGTGACACCCGTAGCAGGAC
TGGTGGATTGAGCGTTGCACTTGCAGGATCTGATGGCCGGGTTCTTGGTGGATGTGTAGCTGGGCAGCTAACGGCTGCGACACCTGTTCAGGTTGTCGTG
GCTAGTTTCATAGCCGAAGGTAAAAAATCAAAGCCCGCTGAGCCACGGAAGGTTGAACCGATGTCCGCACCTCCACAGATGGCCACCTATGTGCCAGCTC
CAGTGGCCAGCCCTCCCTCAGAGGGCACATCCAGCGCATCATCCGATGACTCCGGCAGCCCCATCAACCACGGCGGGATGCCCTACAACCACTCTGGTGG
GCAGCAGCACCAGCAGCAGCACATGCCCCCCGCCTACGCATCAGGCGGCTGGTCGCTCTCGGCGCACCATCAGAACAACAACAGGCATGACGCTGACATG
AAGATGATGTCGAACTAACACCGCATGCTCAAGCCTTCGAAGAGAGCCCCATTTGTTGGCTGGGCTGGAGAGGAGCTGGTACTGCTGTAACGTCTGCCGT
CGACCAGCAATGGCCGACCTGGTAGCTAGGAGATTTAGGTTCTTGCTCTCTGGCATGCTGTTTTTCCCTAAGTAAGATTAATTTAGCCACCGTCTGTAAT
GCTGTAGCTCTCGCTGTCACTAACGTGAGTTTTTATTTTCATGGTCATGTACCTGCTGAGATCTTCACCTTCTAGGCTAGGCGTTTGATCGCTCTCTTCT
GTGGATCATGAATTCTAGAATGCTTTCAGTTTCAATTCAAGAACTCTAGCTTGTTTAAAAAAAAAA
page-top