Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1156  (registered. 2012)
Contig Information
Length 818 bp
Clones alternative view 131 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_EM Dormant seed with water absorption 17
Wh_EMI Dormant seed with water absorption after breaking 29
WH_XN Leaves, plant was grown at constant 23 15
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 46
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig1156
TCGGCATCGGCGCCGTCCGGCGCAGGCCACAGACTCGCTTNNNATGCGTCTGTGCGCCGGCCACTCACGCCGGGTCCTTCAAGTGCCGCTTCCATCGTAC
CAACTCCCAGGGCCACGGCCACGGCCAGGGCCAGGGAAGCCCCTCGTGCCGAATTCAAAACCATCACTCCACGAGCAGACAGGACTGGGAAGAGCTTTGC
TCGACAAGTTCAGGAGTTAGGACCAACCAACGATGAAGAGCAGCACGCTGGTGGCGATCCTAGTCCTCCAGGCCGTCATGGTCATGGGAATCCTCTCACA
CTCACTGGCCGCCGACGACAATTTCCCGAAGTGCTGCGACAACTGCAACTCCTGGTCGGGGGCCCAATTCTGTGACGACGTGGGCCCCAAGTGCCGCGAC
GGCTGCGTGAACTGCCACGTGGTGCAGACGAGGCCCGTGAAGACGTTCCGGTGTGGCGATGGACGCGCCGCCCTCCCAGAGAATCCCTGCCCGCCGCCGT
GCAAAAAGAACTGATCGCTCGCTCGAGCTCACCACACAGGGAGATCGACGTTGCGCCGAAAATAAATAAGAAAGCTCCGACGAGATGAGCAGAAACGGCC
GGTGTGGTGTACATGCACGTGGCCCACGCCCAGCAACACTTGAGAGATAGTTGATGTTGCTCCGTAAATAAACACGTGTATCAGTGTATACATATGCGTC
ACAGCTCAATCAAATAAAAAGTCAGTTTGTTTGTGCGATAAAAAAAAAATGTCCAGTTCACCGGTGAACGGATCCTTCTCGATGCTTAAGCATATGTATG
GTTGTCACAAAAAAAAAA
page-top