Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20445  (registered. 2007)
Contig Information
Length 1004 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit beta-expansin TaEXPB2 [Triticum aestivum]
Score 1253
Evalue 7.42688e-136
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20445
TGTCCTCCCTCCTCGTCACCTACGCCGCCGGCGCCGGGAACTTCAACGATTCCGCCTTCACCGCCGACCCCAACTGGGAGGACGCCAGGGCCACCTGGTA
CGGCGCGCCCACCGGTGCCGGCCCCGACGACGACGGTGGTGCGTGCGGGTTCAAAAACACCAACCAGTACCCCTTCTCCTCCATGACATCGTGCGGCAAC
GAGCCCATCTTCAAGGACGGCAAGGGATGCGGCTCCTGCTACCAGATACGATGCACCAACGACCAGTCCTGCTCCGGCAACCCGGAGACGGTGGTCATCA
CCGACATGAACTACTACCCGGTTGCCAAGTACCACTTCGACCTGAGTGGCACCGCCTTCGGCGCCATGGCCAAGCCCGGCCTCAGCGAGAAGCTCCGCCA
CTCGGGCATCATCGACATCCAGTTCAAGAGAGTGCCGTGCGAGTTCCCCGGTCTCAAGGTGACGTTCCACGTGGAGCAGGGGTCGAACCCGGTGTACTTC
GCGGTGCTGGTGGAGTACGAGGACGGCGACGGCGACGTGGTGCAGGTGGACCTCATGGAGGCCAACTCCGGGACGTGGACGCCGATGCGCGAGTCATGGG
GGTCTATCTGGCGGCTGGACTCCGGCCACCGCCTCCAGGCGCCCTTCTCCATGCGCATCACCAACGAGTCCGGCAAGACGCTGGTGGCCGACAAGGTCAT
CCCGGCCAACTGGGCGCCCAGCACCTTCTACCGTTCCATCGTCCAGTACAGCTGAAGCTGCTGAACTGAACTCATCATTTGGAATCATGCATGCATTGGC
TTGATTTGGTATTTGTACTACCATGGATCGTTTTGCATGGGTACTACTGAGGAGGTTTTTGATTAATTAAGGTTGGGTCATCGGGTGTCATGTAGGCGTC
GTCGTGCATGTGTGTCTTGAATACGTCGGTGGGATATGGAGGAGGGGCACTTTTGCATGTGCACTCCCGCGCCCACCGTCACTGTACCAGTGTGAAGCAG
ACCA
page-top