Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20438  (registered. 2007)
Contig Information
Length 982 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0602900 [Oryza sativa (japonica cultivar-group)] >gi|77551808|gb|ABA94605.1| peptidyl-prolyl cis-trans isomerase, cyclophilin-type family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|77551809|gb|ABA94606.1| peptidyl-prolyl cis-trans isomerase, cyclophilin-type family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|77551810|gb|ABA94607.1| peptidyl-prolyl cis-trans isomerase, cyclophilin-type family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645457|dbj|BAF28598.1| Os11g0602900 [Oryza sativa (japonica cultivar-group)] >gi|215679387|dbj|BAG96527.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765508|dbj|BAG87205.1| unnamed protein product [Oryza sativa Japonica Group]
Score 904
Evalue 2.1092e-95
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20438
AAAATGGCGGGTTTGCTCCGGCACATCGCCGCCGCTCTCCTTTTCCTCGTCACGGCCGCTTCGACCGCCGGTGCTTCCACTTATTACGCCTCGGATCCCA
ACCTCGGATCCGCCCGCGTCGTCTTCCAGTTAAATCATGGTGACATTGAATTCGGCTTCTTTCCTCGTGTTGCACCTAAGACAGTTGAACACATTTTTAA
ACTTGTGCAGCTTGGATGCTATAATACAAATCACTTCTTCCGGGTTGACAAGGGTTTTGTTGCGCAAGTTGCCGATGTCATGGGAGGTAGAAAAGCCCCT
ATGAATAAAGAGCAGGAACAACAGGCAGAGAAATCAATTGTTGGTGAATTTAGTACTGTCAAGCATGTCAGAGGAATTCTCTCAATGGGAAGGTATTCTG
ACCCAGACAGTGCCTCCTCTTCCTTTTCTATCCTCCTTGGTGATGCTCCCCACCTTGATGGCCAGTATGCTGTATTTGGGAGGGTGACTAAGGGTGACGA
TACATTAAGAAAACTAGAGCGCCTGCCAACCCATAAAGAAGGCATTTTTGTAATGCCAATTGAGCGCATTGAGATTCTGTCGACATACTATTATGATATT
GATGTAGAGAGCTGTGAGCCAGAGAAGTCTATTCTTAAGAGGAGACTTTCTGAATCAGCATCAGAAGTTGAGAGATGGAGACGAAAATGCTTCGCATGAT
CCAGCGATTGAGTGTCTTTATTTTCCTTTCGGTCTCACTGAGAAGACATGTGTTTCAAAAGGACATCCATATTACCTCTTCCAGGATTTAGAGTGCATGT
GCATTCCAAGGAGAGGGGTCAGACTTGTACTATGTCCAAATGCGTTGTACCATGTAATTTTTCCATGAGTTTGATGTTACTAGGTCTGCACGTTTAGCAT
TGTTTCTCTATGGTGACCAAAATTTTGTCTTGTACCTATTTGGCATGCTTAGCACATGCAGAACGTGAAGCATTGGGAAGGT
page-top