Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11554  (registered. 2012)
Contig Information
Length 823 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_SH - 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XE Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115441699|ref|NP_001045129.1|| Os01g0905700 [Oryza sativa (japonica cultivar-group)]
Score 315
Evalue 5.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11554
GACTCATTACCCAGCAACTGTTCTTCTTTAATTATAGCTTGGCAATTTGCCAGAGCATCGATACCAAACAAGTAAAAACCTTCATCAGGATCCATCAAGC
ACTTCATTTTTCTGTACACTTATTACCACACCAATGCGATTGCGCAAAGCCAGAGCAACAAATAATGGCGCTTGGCAAACGGACTGACTGACGGCTTCGG
CTTTCGCTTGCCAGACTCGATCTGCGGAGGATGGTCGGCTGCCGGAGAACCCTTGCACTGTAGTACATCATCGCTATCTCCACGCCCAGCCGGAGCTGGA
GCCGGAGCGTCGCTAGACTAGGTAGTCATAGTAGACAAGCAGGAGGTTGTCCGGGACGATGAGGGGCAGGCTGTCGATGAAGCTGTGGAAGTGCCTCACA
TTCTCCTTCTCCAGGGTCACCGGGTCGATCACATCTTCGTCGCCGGTGAGCACCCACAGGTCCCTGGACTGGACTCGCTTCAGGCTTCCGCGGCAGAATG
GGCACGACTGAGATCTTGTGTACCAGTCTCGGTAACAGTTGATGCACATGGCATGGTTGCAGTTGGGAAGGACCATCTTGGTGCAGGTCTCCAAGCAAAT
GCCGCACTCATCTTCCCTCTCGGCGTCCTTATCATCGGCGTAAAGCTTCCGGCGGCCGCCGCTGTCGCCGTGCCCCTTGCACCACCCCTTCTCCTTGCAG
TCTCTCGCCATGACGTTCTCCTCAATTTGTTGCAAGTAGGGGTATATTATGGCGTAGAATTCTTTGNNNCTCGCTCGCCTTTCGATGGTGGATATGGATG
CATCCCCATCAACATAAACCTTG
page-top