Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20380  (registered. 2007)
Contig Information
Length 749 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Defender against cell death 2; Short=DAD-2 >gi|5918185|emb|CAB56224.1| defender against death (dad) 2 [Hordeum vulgare]
Score 554
Evalue 5.01191e-55
Total Hit Count 164
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20380
GCCTCCGCCCTGGGGCTGGATCCTTCCCGGTCCTTATCGGCCCTCTCTCTCCCGAACCCCGCGCCCCGTTCGCGGCCGGGTTTCTAGATCTGAGAGCCGC
CCTGTCCGTCCTCCGCCGTGATCTGATTTCTTGAACTCTGATCTACTAGCTCGAAGCGGCGGAAGCAAGGATGCCGAAGGCCGCGGGGGATGCCAAGCTC
CTGATCCAGTCCCTCACCAAGGCCTACGCCACCACGCCCACGAATCTCAAGATCATTGACCTGTACGTGGTTTTCGCGGTCGCCACTGCCCTGGTTCAGG
TCGTTTACATGGGAATAGTTGGGTCATTCCCCTTCAACTCTTTCCTGTCTGGTGTCCTGTCATGCATTGGAACTGCAGTGCTTGGTGTTTGCCTCCGTAT
TCAAGTCAACAAGGACAACAAGGAATTCAAGGATCTTCCCCCGGAGAGGGCCTTTGCTGATTTCGTCCTGTGCAATCTGGTGCTCCACCTGGTGATCATG
AACTTCCTTGGATGAGCAACTGTCATACAAGCTGTCGAGATTTTGTAGTGTCCTAATGTCTAAGACTGTCAGCATGTTAGATATTCATGTGGCACCATAC
ACACCTATGTAATCCGAGAGTTTCTCTATGAACTATAAGAATTCAGTGGATTTAGTGTTAACTTTGTGGAACATGAGAACTTATTCGATTGAGTGAAGAC
AGCGAAAAGTGATCACTTAAATATTAGTATTGTTCACTCAAAAAAAAAA
page-top