Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20374  (registered. 2007)
Contig Information
Length 957 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0114700 [Oryza sativa (japonica cultivar-group)] >gi|7248408|dbj|BAA92731.1| unknown protein [Oryza sativa Japonica Group] >gi|55296186|dbj|BAD67904.1| unknown protein [Oryza sativa Japonica Group] >gi|113594646|dbj|BAF18520.1| Os06g0114700 [Oryza sativa (japonica cultivar-group)] >gi|215692581|dbj|BAG88001.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197447|gb|EEC79874.1| hypothetical protein OsI_21376 [Oryza sativa Indica Group]
Score 913
Evalue 1.81827e-96
Total Hit Count 135
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20374
TTTTTTTTTTAAAATTCAAATATCCATACCGACGAAACAGGCATGCCGCCGCCTTTCTCAAGTCTCAAACAAAGAAAAAGAGAAGACTGATGAACCTAGC
TAATAATAACGGTAACCAAGCTGCTGCTATTGTTCTAACCTGCAGGGCTATACAAACCAAACTCGCCAACATAGCGTTCATGTGGGCCGTCGAAACGGCT
TAGGTACTACGACTGCGATCACGGGAACTGCTGCCGGTTGCAAGTGTCCTCATGGGCGACCCTCGAAATGGCTGGCTTGAATATGGCTGTGATCACTCAT
GGGAACTGTTGCCGGTTGTAGGTGTCCTCATGGACGAACACCGGCTCGCTGCTCTGCTGCGGGATCACGGGCTGGCCCATGGAGATGCCCTGGTTCTGCT
GCGGGCCCCAGCTCGGCGGGCCTTTCGACGACGTCAGGGCCACGTAGTAGACTATGGCCAGGGCCACGCTCGCGAGGGAGAGCACCGCCCCTCCGGAGAA
GACCCCCGGCTTGACGACGTAGCAGAAGCTGCCGAAGTACATGTTCTCCTGGCCCCTTTGGTCGTTCAGCGCGGCTCCGGTCAGCAGGAGAAGGAACGCG
ATTATGAAAGTGACCCAAGATACGATGAATGAGATCAGAGCCACACTCCAGTTAGTGTCTGAAGGAACCGGATGCCTCTTACAACAGATGCAACCAGCAA
CTGTATTGATAATAGCCTGTGCGACCATAAGGGCAACTGCAGACATCAACCCAAGGCCTAACGCAGGGCTTCTTGGGTATATGCATTCACCTGGAGAAGA
GTCGGTTTGCACATCTGAAACCTTGACGCGGGTGCCCTCGGCGGCGAAGCCTAGCGCGGCGGAGAGGACGCCGAGGAAGCCGACGAGCGCGCACACCACC
ACCGCCTTCCGCTCCATCCCCTCCTTCTCTCCCCTCCTCCACCAACCTCGCACCAAC
page-top