Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11550  (registered. 2012)
Contig Information
Length 784 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 2
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|188038088|gb|ACD46678.1|| hypothetical protein [Aegilops tauschii]
Score 337
Evalue 7.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11550
TTTTTTTTTTGAACCAGCTTGAAATTTATCCAAACGAACAAAAAACAAGTCTTCAGACTCTTGTCACACACGCTAGGTAATAACAACATAACAATTCACC
AAGGTTCCGACTGACTATATAACGATAATACGAGCAAAGCTACTGCAGAAACAAGTACGACAGACGGTCTAAAGAGCCAACAAGGCTTCTGCTACAACCA
AACCATACGAATACCATGCCTCTCGAAAGGGCAGATTCAGAGGGCACGCGACCAAGACGAACCAATCACCTGAACTTCGGCTTCTTCAAGGGCGGCCCTC
CCTTGGAGCTACTGGGAGGTGGGCGAGACTTGTTGCCGCTGCTGCTGCCACCACGCTGCGGCAGCAGAGCATGCTTGCTGCTGCTAGGACCACCACGCTG
CGGTGGTGCGCCCGACTTGCTGAAGGTCTTGACCTTGCGGCGCCTCCTTTCTTCCTCGCTGTCAGACTCTGCGCCGTGATCCCGGTCCGCGTTGGTCGCC
TCCCGCTCCAGCTCGTCCCAGGTCTTGCCCTTCTCTTCCTCAGAGTCTTCATCAGAATCCTCTTCCTCATCCTCGTCTGATTCCACCAAGGACGCGCTGT
CGGAGTCTTCTTCTTCTGATTCAGACTCGGGCTCAGCATCAGAAGGCTCATACCCCTGGTCTGATTCCTCTGTTTCCTCTGCCTCAGAATCACTTGCCTC
CATGTTCAGGAACTCCCAGCCACCATCGTCAACAAACTTCTGNNNGTCATCAATGATAGTCTTCAGGATAGGGCGCCAGTTCAG
page-top