Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20350  (registered. 2007)
Contig Information
Length 818 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cp protein [Zea mays]
Score 842
Evalue 2.38382e-88
Total Hit Count 191
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20350
AGTCCGGTAGGTCGCGGCAGCGCTCTCAACTCCATCGCCTTCCTCCGATTCCGGCGATCCAGACCGAATCCGGCCGATTCGAGGCGGACTGGGGGTTCGG
GTTCGGGGCGGGGAAGAGGGGAGGAGGGGGAGATGGACCAGGTGCTGAACAAGGTGGGGAGCTACTGGTTCAGCAAGAGGGCCAGCAAGGAGATCGACTC
CATCGGCGACGACCTCAACTCGGTCTCTTCCAGTATTGGCGGGGGAGCTAAATGGATGGTGAACAAGATCAAAGGCAAGCTGCAGAAAGCATTACCAGAT
CTTCTCAAAGAATATGACATGCCAGCAGGCCTCTTCCCACGGGACACAACTAATTACGAGTTCAATGAAGAGACAAAGAAGCTGACAGTGTACATCCCGT
CAGCTTGTGACGTCGGGTACAAGGACTCATCGGTGGTGCGGTTCTTCACCTGTGTGACCGGCTACCTCGAGAAGGGAAAGCTTTCTGACATCGAGGGCAT
GAAGACCAAGGTGCTTGTATGGACCAAGGTGACCTCCATCAAGACCGAGGGCTCAAAGGTCCATTTCACTGCCGGCATGAAGAAGACCCGCAGCCGCGAT
GCGTATGAGGTTGTCAGAGATGGCATCATCATAGACAAGTTCTAGAGCATACCTGTACCTGGGCTGGCAGGTGCAATGTAATTACTTAGATATGCTACAT
TGGAATCTGTTGTGCTATCGGATCGGCCTATTAACCAACTGTGTTGCTCAAATCTCCCATCCATGACTTTCTCTATATCTTGACAATGTGTGCTTGTTTT
GCTGTCATCCTGATTCTT
page-top